R Under development (unstable) (2026-07-21 r90286) -- "Unsuffered Consequences" Copyright (C) 2026 The R Foundation for Statistical Computing Platform: x86_64-pc-linux-gnu R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. Natural language support but running in an English locale R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. > pkgname <- "stringi" > source(file.path(R.home("share"), "R", "examples-header.R")) > options(warn = 1) > library('stringi') > > base::assign(".oldSearch", base::search(), pos = 'CheckExEnv') > base::assign(".old_wd", base::getwd(), pos = 'CheckExEnv') > cleanEx() > nameEx("operator_add") > ### * operator_add > > flush(stderr()); flush(stdout()) > > ### Name: %s+% > ### Title: Concatenate Two Character Vectors > ### Aliases: %s+% oper_plus operator_add operator_plus %stri+% > > ### ** Examples > > c('abc', '123', 'xy') %s+% letters[1:6] [1] "abca" "123b" "xyc" "abcd" "123e" "xyf" > 'ID_' %s+% 1:5 [1] "ID_1" "ID_2" "ID_3" "ID_4" "ID_5" > > > > > cleanEx() > nameEx("operator_compare") > ### * operator_compare > > flush(stderr()); flush(stdout()) > > ### Name: %s<% > ### Title: Compare Strings with or without Collation > ### Aliases: %s<% operator_compare oper_comparison oper_compare %s<=% %s>% > ### %s>=% %s==% %s!=% %s===% %s!==% %stri<% %stri<=% %stri>% %stri>=% > ### %stri==% %stri!=% %stri===% %stri!==% > > ### ** Examples > > 'a' %stri<% 'b' [1] TRUE > c('a', 'b', 'c') %stri>=% 'b' [1] FALSE TRUE TRUE > > > > > cleanEx() > nameEx("operator_dollar") > ### * operator_dollar > > flush(stderr()); flush(stdout()) > > ### Name: %s$% > ### Title: C-Style Formatting with 'stri_sprintf' as a Binary Operator > ### Aliases: %s$% operator_dollar oper_dollar %stri$% > > ### ** Examples > > "value='%d'" %s$% 3 [1] "value='3'" > "value='%d'" %s$% 1:3 [1] "value='1'" "value='2'" "value='3'" > "%s='%d'" %s$% list("value", 3) [1] "value='3'" > "%s='%d'" %s$% list("value", 1:3) [1] "value='1'" "value='2'" "value='3'" > "%s='%d'" %s$% list(c("a", "b", "c"), 1) [1] "a='1'" "b='1'" "c='1'" > "%s='%d'" %s$% list(c("a", "b", "c"), 1:3) [1] "a='1'" "b='2'" "c='3'" > > x <- c("abcd", "\u00DF\u00B5\U0001F970", "abcdef") > cat("[%6s]" %s$% x, sep="\n") # width used, not the number of bytes [ abcd] [ ßµ🥰] [abcdef] > > > > > cleanEx() > nameEx("stri_compare") > ### * stri_compare > > flush(stderr()); flush(stdout()) > > ### Name: stri_compare > ### Title: Compare Strings with or without Collation > ### Aliases: stri_compare stri_cmp stri_cmp_eq stri_cmp_neq stri_cmp_equiv > ### stri_cmp_nequiv stri_cmp_lt stri_cmp_gt stri_cmp_le stri_cmp_ge > > ### ** Examples > > # in Polish, ch < h: > stri_cmp_lt('hladny', 'chladny', locale='pl_PL') [1] FALSE > > # in Slovak, ch > h: > stri_cmp_lt('hladny', 'chladny', locale='sk_SK') [1] TRUE > > # < or > (depends on locale): > stri_cmp('hladny', 'chladny') [1] 1 > > # ignore case differences: > stri_cmp_equiv('hladny', 'HLADNY', strength=2) [1] TRUE > > # also ignore diacritical differences: > stri_cmp_equiv('hladn\u00FD', 'hladny', strength=1, locale='sk_SK') [1] TRUE > > marios <- c('Mario', 'mario', 'M\\u00e1rio', 'm\\u00e1rio') > stri_cmp_equiv(marios, 'mario', case_level=TRUE, strength=2L) [1] FALSE TRUE FALSE FALSE > stri_cmp_equiv(marios, 'mario', case_level=TRUE, strength=1L) [1] FALSE TRUE FALSE FALSE > stri_cmp_equiv(marios, 'mario', strength=1L) [1] TRUE TRUE FALSE FALSE > stri_cmp_equiv(marios, 'mario', strength=2L) [1] TRUE TRUE FALSE FALSE > > # non-Unicode-normalized vs normalized string: > stri_cmp_equiv(stri_trans_nfkd('\u0105'), '\u105') [1] TRUE > > # note the difference: > stri_cmp_eq(stri_trans_nfkd('\u0105'), '\u105') [1] FALSE > > # ligatures: > stri_cmp_equiv('\ufb00', 'ff', strength=2) [1] TRUE > > # phonebook collation > stri_cmp_equiv('G\u00e4rtner', 'Gaertner', locale='de_DE@collation=phonebook', strength=1L) [1] TRUE > stri_cmp_equiv('G\u00e4rtner', 'Gaertner', locale='de_DE', strength=1L) [1] FALSE > > > > > cleanEx() > nameEx("stri_count") > ### * stri_count > > flush(stderr()); flush(stdout()) > > ### Name: stri_count > ### Title: Count the Number of Pattern Occurrences > ### Aliases: stri_count stri_count_charclass stri_count_coll > ### stri_count_fixed stri_count_regex > > ### ** Examples > > s <- 'Lorem ipsum dolor sit amet, consectetur adipisicing elit.' > stri_count(s, fixed='dolor') [1] 1 > stri_count(s, regex='\\p{L}+') [1] 8 > > stri_count_fixed(s, ' ') [1] 7 > stri_count_fixed(s, 'o') [1] 4 > stri_count_fixed(s, 'it') [1] 2 > stri_count_fixed(s, letters) [1] 2 0 3 2 5 0 1 0 7 0 0 2 3 2 4 2 0 3 4 5 2 0 0 0 0 0 > stri_count_fixed('babab', 'b') [1] 3 > stri_count_fixed(c('stringi', '123'), 'string') [1] 1 0 > > stri_count_charclass(c('stRRRingi', 'STrrrINGI', '123'), + c('\\p{Ll}', '\\p{Lu}', '\\p{Zs}')) [1] 6 6 0 > stri_count_charclass(' \t\n', '\\p{WHITE_SPACE}') # white space - binary property [1] 3 > stri_count_charclass(' \t\n', '\\p{Z}') # white-space - general category (note the difference) [1] 1 > > stri_count_regex(s, '(s|el)it') icu74/i18n/rematch.cpp:2524:25: runtime error: index 1 out of bounds for type 'long int [1]' #0 0x7bddf4eccaae in icu_74_stringi::RegexMatcher::resetStack() icu74/i18n/rematch.cpp:2524 #1 0x7bddf4f14a91 in icu_74_stringi::RegexMatcher::MatchChunkAt(int, signed char, UErrorCode&) icu74/i18n/rematch.cpp:4328 #2 0x7bddf4e93ed0 in icu_74_stringi::RegexMatcher::findUsingChunk(UErrorCode&) icu74/i18n/rematch.cpp:1026 #3 0x7bddf38e076a in stri_count_regex(SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_count.cpp:96 #4 0x00000075d47a in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:760 #5 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #6 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #7 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #8 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #9 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #10 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #11 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #12 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #13 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #14 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #15 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #16 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #17 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #18 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #19 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) icu74/i18n/rematch.cpp:4454:33: runtime error: index 2 out of bounds for type 'long int [1]' #0 0x7bddf4f3bcaf in icu_74_stringi::RegexMatcher::MatchChunkAt(int, signed char, UErrorCode&) icu74/i18n/rematch.cpp:4454 #1 0x7bddf4e93ed0 in icu_74_stringi::RegexMatcher::findUsingChunk(UErrorCode&) icu74/i18n/rematch.cpp:1026 #2 0x7bddf38e076a in stri_count_regex(SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_count.cpp:96 #3 0x00000075d47a in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:760 #4 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #5 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #6 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #7 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #8 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #9 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #10 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #11 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #12 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #13 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #14 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #15 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #16 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #17 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #18 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) icu74/i18n/rematch.cpp:4461:57: runtime error: index 2 out of bounds for type 'long int [1]' #0 0x7bddf4f3b7b5 in icu_74_stringi::RegexMatcher::MatchChunkAt(int, signed char, UErrorCode&) icu74/i18n/rematch.cpp:4461 #1 0x7bddf4e93ed0 in icu_74_stringi::RegexMatcher::findUsingChunk(UErrorCode&) icu74/i18n/rematch.cpp:1026 #2 0x7bddf38e076a in stri_count_regex(SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_count.cpp:96 #3 0x00000075d47a in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:760 #4 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #5 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #6 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #7 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #8 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #9 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #10 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #11 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #12 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #13 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #14 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #15 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #16 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #17 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #18 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) icu74/i18n/rematch.cpp:4462:33: runtime error: index 1 out of bounds for type 'long int [1]' #0 0x7bddf4f3b80e in icu_74_stringi::RegexMatcher::MatchChunkAt(int, signed char, UErrorCode&) icu74/i18n/rematch.cpp:4462 #1 0x7bddf4e93ed0 in icu_74_stringi::RegexMatcher::findUsingChunk(UErrorCode&) icu74/i18n/rematch.cpp:1026 #2 0x7bddf38e076a in stri_count_regex(SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_count.cpp:96 #3 0x00000075d47a in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:760 #4 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #5 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #6 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #7 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #8 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #9 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #10 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #11 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #12 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #13 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #14 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #15 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #16 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #17 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #18 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) [1] 2 > stri_count_regex(s, 'i.i') [1] 2 > stri_count_regex(s, '.it') [1] 2 > stri_count_regex('bab baab baaab', c('b.*?b', 'b.b')) [1] 3 2 > stri_count_regex(c('stringi', '123'), '^(s|1)') [1] 1 1 > > > > > cleanEx() > nameEx("stri_count_boundaries") > ### * stri_count_boundaries > > flush(stderr()); flush(stdout()) > > ### Name: stri_count_boundaries > ### Title: Count the Number of Text Boundaries > ### Aliases: stri_count_boundaries stri_count_words > > ### ** Examples > > test <- 'The\u00a0above-mentioned features are very useful. Spam, spam, eggs, bacon, and spam.' > stri_count_boundaries(test, type='word') icu74/common/rbbi.cpp:874:32: runtime error: index 13 out of bounds for type 'unsigned char [1]' #0 0x7bddf3c93c4c in handleNext, icu_74_stringi::TrieFunc8> icu74/common/rbbi.cpp:874 #1 0x7bddf3c93c4c in icu_74_stringi::RuleBasedBreakIterator::handleNext() icu74/common/rbbi.cpp:741 #2 0x7bddf3c7081d in icu_74_stringi::RuleBasedBreakIterator::BreakCache::populateFollowing() icu74/common/rbbi_cache.cpp:484 #3 0x7bddf3c720f2 in icu_74_stringi::RuleBasedBreakIterator::BreakCache::nextOL() icu74/common/rbbi_cache.cpp:277 #4 0x7bddf3c7d014 in icu_74_stringi::RuleBasedBreakIterator::next() icu74/common/rbbi.cpp:594 #5 0x7bddf3784244 in StriRuleBasedBreakIterator::next() /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_brkiter.cpp:338 #6 0x7bddf3896cf6 in stri_count_boundaries(SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_boundaries_count.cpp:77 #7 0x00000075d4c6 in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:757 #8 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #9 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #10 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #11 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #12 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #13 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #14 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #15 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #16 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #17 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #18 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #19 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #20 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #21 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #22 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) icu74/common/rbbi.cpp:874:32: runtime error: index 1 out of bounds for type 'unsigned char [1]' #0 0x7bddf3c8c05d in handleNext, icu_74_stringi::TrieFunc8> icu74/common/rbbi.cpp:874 #1 0x7bddf3c8c05d in icu_74_stringi::RuleBasedBreakIterator::handleNext() icu74/common/rbbi.cpp:741 #2 0x7bddf3c70c0a in icu_74_stringi::RuleBasedBreakIterator::BreakCache::populateFollowing() icu74/common/rbbi_cache.cpp:512 #3 0x7bddf3c720f2 in icu_74_stringi::RuleBasedBreakIterator::BreakCache::nextOL() icu74/common/rbbi_cache.cpp:277 #4 0x7bddf3c7d014 in icu_74_stringi::RuleBasedBreakIterator::next() icu74/common/rbbi.cpp:594 #5 0x7bddf3784244 in StriRuleBasedBreakIterator::next() /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_brkiter.cpp:338 #6 0x7bddf3896cf6 in stri_count_boundaries(SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_boundaries_count.cpp:77 #7 0x00000075d4c6 in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:757 #8 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #9 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #10 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #11 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #12 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #13 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #14 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #15 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #16 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #17 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #18 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #19 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #20 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #21 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #22 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) [1] 31 > stri_count_boundaries(test, type='sentence') icu74/common/rbbi.cpp:874:32: runtime error: index 2 out of bounds for type 'unsigned char [1]' #0 0x7bddf3c8fa19 in handleNext, icu_74_stringi::TrieFunc8> icu74/common/rbbi.cpp:874 #1 0x7bddf3c8fa19 in icu_74_stringi::RuleBasedBreakIterator::handleNext() icu74/common/rbbi.cpp:741 #2 0x7bddf3c7081d in icu_74_stringi::RuleBasedBreakIterator::BreakCache::populateFollowing() icu74/common/rbbi_cache.cpp:484 #3 0x7bddf3c720f2 in icu_74_stringi::RuleBasedBreakIterator::BreakCache::nextOL() icu74/common/rbbi_cache.cpp:277 #4 0x7bddf3c7d014 in icu_74_stringi::RuleBasedBreakIterator::next() icu74/common/rbbi.cpp:594 #5 0x7bddf3784244 in StriRuleBasedBreakIterator::next() /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_brkiter.cpp:338 #6 0x7bddf3896cf6 in stri_count_boundaries(SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_boundaries_count.cpp:77 #7 0x00000075d4c6 in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:757 #8 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #9 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #10 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #11 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #12 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #13 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #14 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #15 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #16 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #17 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #18 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #19 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #20 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #21 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #22 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) [1] 2 > stri_count_boundaries(test, type='character') [1] 83 > stri_count_words(test) [1] 13 > > test2 <- stri_trans_nfkd('\u03c0\u0153\u0119\u00a9\u00df\u2190\u2193\u2192') > stri_count_boundaries(test2, type='character') [1] 8 > stri_length(test2) [1] 9 > stri_numbytes(test2) [1] 20 > > > > > cleanEx() > nameEx("stri_datetime_add") > ### * stri_datetime_add > > flush(stderr()); flush(stdout()) > > ### Name: stri_datetime_add > ### Title: Date and Time Arithmetic > ### Aliases: stri_datetime_add stri_datetime_add<- > > ### ** Examples > > x <- stri_datetime_now() > print(x) [1] "2026-07-22 07:06:41 BST" > stri_datetime_add(x, units='months') <- 2 > print(x) [1] "2026-09-22 07:06:41 BST" > > x <- stri_datetime_create(2025, 4, 20) > print(x) [1] "2025-04-20 BST" > stri_datetime_add(x, -2, units='months') [1] "2025-02-20 GMT" > stri_datetime_add(x, 1, units='years') [1] "2026-04-20 BST" > stri_datetime_add(x, 1, units='years', locale='@calendar=hebrew') [1] "2026-04-09 BST" > > stri_datetime_add(stri_datetime_create(2024, 1, 31), 1, units='months') [1] "2024-02-29 GMT" > > > > > cleanEx() > nameEx("stri_datetime_create") > ### * stri_datetime_create > > flush(stderr()); flush(stdout()) > > ### Name: stri_datetime_create > ### Title: Create a Date-Time Object > ### Aliases: stri_datetime_create > > ### ** Examples > > stri_datetime_create(2015, 12, 31, 23, 59, 59.999) [1] "2015-12-31 23:59:59 GMT" > stri_datetime_create(5775, 8, 1, locale='@calendar=hebrew') # 1 Nisan 5775 -> 2015-03-21 [1] "2015-03-21 GMT" > stri_datetime_create(2015, 02, 29) [1] NA > stri_datetime_create(2015, 02, 29, lenient=TRUE) [1] "2015-03-01 GMT" > stri_datetime_create(hour=15, minute=59) [1] "2026-07-22 15:59:00 BST" > > > > > cleanEx() > nameEx("stri_datetime_fields") > ### * stri_datetime_fields > > flush(stderr()); flush(stdout()) > > ### Name: stri_datetime_fields > ### Title: Get Values for Date and Time Fields > ### Aliases: stri_datetime_fields > > ### ** Examples > > stri_datetime_fields(stri_datetime_now()) Year Month Day Hour Minute Second Millisecond WeekOfYear WeekOfMonth 1 2026 7 22 7 6 41 667 30 4 DayOfYear DayOfWeek Hour12 AmPm Era 1 203 4 7 1 2 > stri_datetime_fields(stri_datetime_now(), locale='@calendar=hebrew') Year Month Day Hour Minute Second Millisecond WeekOfYear WeekOfMonth 1 5786 12 8 7 6 41 688 44 2 DayOfYear DayOfWeek Hour12 AmPm Era 1 303 4 7 1 1 > stri_datetime_symbols(locale='@calendar=hebrew')$Month[ + stri_datetime_fields(stri_datetime_now(), locale='@calendar=hebrew')$Month + ] [1] "Av" > > > > > cleanEx() > nameEx("stri_datetime_format") > ### * stri_datetime_format > > flush(stderr()); flush(stdout()) > > ### Name: stri_datetime_format > ### Title: Date and Time Formatting and Parsing > ### Aliases: stri_datetime_format stri_datetime_parse > > ### ** Examples > > x <- c('2015-02-28', '2015-02-29') > stri_datetime_parse(x, 'yyyy-MM-dd') [1] "2015-02-28 GMT" NA > stri_datetime_parse(x, 'yyyy-MM-dd', lenient=TRUE) [1] "2015-02-28 GMT" "2015-03-01 GMT" > stri_datetime_parse(x %s+% " 17:13", "yyyy-MM-dd HH:mm") [1] "2015-02-28 17:13:00 GMT" NA > stri_datetime_parse('19 lipca 2015', 'date_long', locale='pl_PL') [1] "2015-07-19 BST" > stri_datetime_format(stri_datetime_now(), 'datetime_relative_medium') [1] "today, 07:06:41" > > > > > cleanEx() > nameEx("stri_datetime_fstr") > ### * stri_datetime_fstr > > flush(stderr()); flush(stdout()) > > ### Name: stri_datetime_fstr > ### Title: Convert 'strptime'-Style Format Strings > ### Aliases: stri_datetime_fstr > > ### ** Examples > > stri_datetime_fstr('%Y-%m-%d %H:%M:%S') [1] "yyyy'-'MM'-'dd' 'HH':'mm':'ss" > > > > > cleanEx() > nameEx("stri_datetime_symbols") > ### * stri_datetime_symbols > > flush(stderr()); flush(stdout()) > > ### Name: stri_datetime_symbols > ### Title: List Localizable Date-Time Formatting Data > ### Aliases: stri_datetime_symbols > > ### ** Examples > > stri_datetime_symbols() # uses the Gregorian calendar in most locales $Month [1] "January" "February" "March" "April" "May" "June" [7] "July" "August" "September" "October" "November" "December" $Weekday [1] "Sunday" "Monday" "Tuesday" "Wednesday" "Thursday" "Friday" [7] "Saturday" $Quarter [1] "1st quarter" "2nd quarter" "3rd quarter" "4th quarter" $AmPm [1] "am" "pm" $Era [1] "Before Christ" "Anno Domini" > stri_datetime_symbols('@calendar=hebrew') $Month [1] "Tishri" "Heshvan" "Kislev" "Tevet" "Shevat" "Adar I" "Adar" [8] "Nisan" "Iyar" "Sivan" "Tamuz" "Av" "Elul" "Adar II" $Weekday [1] "Sunday" "Monday" "Tuesday" "Wednesday" "Thursday" "Friday" [7] "Saturday" $Quarter [1] "1st quarter" "2nd quarter" "3rd quarter" "4th quarter" $AmPm [1] "am" "pm" $Era [1] "AM" > stri_datetime_symbols('he_IL@calendar=hebrew') $Month [1] "תשרי" "חשוון" "כסלו" "טבת" "שבט" "אדר א׳" "אדר" "ניסן" [9] "אייר" "סיוון" "תמוז" "אב" "אלול" "אדר ב׳" $Weekday [1] "יום ראשון" "יום שני" "יום שלישי" "יום רביעי" "יום חמישי" "יום שישי" [7] "יום שבת" $Quarter [1] "רבעון 1" "רבעון 2" "רבעון 3" "רבעון 4" $AmPm [1] "לפנה״צ" "אחה״צ" $Era [1] "לבריאת העולם" > stri_datetime_symbols('@calendar=islamic') $Month [1] "Muharram" "Safar" "Rabiʻ I" "Rabiʻ II" "Jumada I" [6] "Jumada II" "Rajab" "Shaʻban" "Ramadan" "Shawwal" [11] "Dhuʻl-Qiʻdah" "Dhuʻl-Hijjah" $Weekday [1] "Sunday" "Monday" "Tuesday" "Wednesday" "Thursday" "Friday" [7] "Saturday" $Quarter [1] "1st quarter" "2nd quarter" "3rd quarter" "4th quarter" $AmPm [1] "am" "pm" $Era [1] "AH" > stri_datetime_symbols('@calendar=persian') Warning in stri_datetime_symbols("@calendar=persian") : A resource bundle lookup returned a result either from the root or the default locale. $Month [1] "Farvardin" "Ordibehesht" "Khordad" "Tir" "Mordad" [6] "Shahrivar" "Mehr" "Aban" "Azar" "Dey" [11] "Bahman" "Esfand" $Weekday [1] "Sunday" "Monday" "Tuesday" "Wednesday" "Thursday" "Friday" [7] "Saturday" $Quarter [1] "1st quarter" "2nd quarter" "3rd quarter" "4th quarter" $AmPm [1] "am" "pm" $Era [1] "AP" > stri_datetime_symbols('@calendar=indian') $Month [1] "Chaitra" "Vaisakha" "Jyaistha" "Asadha" "Sravana" [6] "Bhadra" "Asvina" "Kartika" "Agrahayana" "Pausa" [11] "Magha" "Phalguna" $Weekday [1] "Sunday" "Monday" "Tuesday" "Wednesday" "Thursday" "Friday" [7] "Saturday" $Quarter [1] "1st quarter" "2nd quarter" "3rd quarter" "4th quarter" $AmPm [1] "am" "pm" $Era [1] "Saka" > stri_datetime_symbols('@calendar=coptic') Warning in stri_datetime_symbols("@calendar=coptic") : A resource bundle lookup returned a result either from the root or the default locale. $Month [1] "Tout" "Baba" "Hator" "Kiahk" "Toba" "Amshir" [7] "Baramhat" "Baramouda" "Bashans" "Paona" "Epep" "Mesra" [13] "Nasie" $Weekday [1] "Sunday" "Monday" "Tuesday" "Wednesday" "Thursday" "Friday" [7] "Saturday" $Quarter [1] "1st quarter" "2nd quarter" "3rd quarter" "4th quarter" $AmPm [1] "am" "pm" $Era [1] "ERA0" "ERA1" > stri_datetime_symbols('@calendar=japanese') $Month [1] "January" "February" "March" "April" "May" "June" [7] "July" "August" "September" "October" "November" "December" $Weekday [1] "Sunday" "Monday" "Tuesday" "Wednesday" "Thursday" "Friday" [7] "Saturday" $Quarter [1] "1st quarter" "2nd quarter" "3rd quarter" "4th quarter" $AmPm [1] "am" "pm" $Era [1] "Taika (645–650)" "Hakuchi (650–671)" "Hakuhō (672–686)" [4] "Shuchō (686–701)" "Taihō (701–704)" "Keiun (704–708)" [7] "Wadō (708–715)" "Reiki (715–717)" "Yōrō (717–724)" [10] "Jinki (724–729)" "Tenpyō (729–749)" "Tenpyō-kampō (749–749)" [13] "Tenpyō-shōhō (749–757)" "Tenpyō-hōji (757–765)" "Tenpyō-jingo (765–767)" [16] "Jingo-keiun (767–770)" "Hōki (770–780)" "Ten-ō (781–782)" [19] "Enryaku (782–806)" "Daidō (806–810)" "Kōnin (810–824)" [22] "Tenchō (824–834)" "Jōwa (834–848)" "Kajō (848–851)" [25] "Ninju (851–854)" "Saikō (854–857)" "Ten-an (857–859)" [28] "Jōgan (859–877)" "Gangyō (877–885)" "Ninna (885–889)" [31] "Kanpyō (889–898)" "Shōtai (898–901)" "Engi (901–923)" [34] "Enchō (923–931)" "Jōhei (931–938)" "Tengyō (938–947)" [37] "Tenryaku (947–957)" "Tentoku (957–961)" "Ōwa (961–964)" [40] "Kōhō (964–968)" "Anna (968–970)" "Tenroku (970–973)" [43] "Ten’en (973–976)" "Jōgen (976–978)" "Tengen (978–983)" [46] "Eikan (983–985)" "Kanna (985–987)" "Eien (987–989)" [49] "Eiso (989–990)" "Shōryaku (990–995)" "Chōtoku (995–999)" [52] "Chōhō (999–1004)" "Kankō (1004–1012)" "Chōwa (1012–1017)" [55] "Kannin (1017–1021)" "Jian (1021–1024)" "Manju (1024–1028)" [58] "Chōgen (1028–1037)" "Chōryaku (1037–1040)" "Chōkyū (1040–1044)" [61] "Kantoku (1044–1046)" "Eishō (1046–1053)" "Tengi (1053–1058)" [64] "Kōhei (1058–1065)" "Jiryaku (1065–1069)" "Enkyū (1069–1074)" [67] "Shōho (1074–1077)" "Shōryaku (1077–1081)" "Eihō (1081–1084)" [70] "Ōtoku (1084–1087)" "Kanji (1087–1094)" "Kahō (1094–1096)" [73] "Eichō (1096–1097)" "Jōtoku (1097–1099)" "Kōwa (1099–1104)" [76] "Chōji (1104–1106)" "Kashō (1106–1108)" "Tennin (1108–1110)" [79] "Ten-ei (1110–1113)" "Eikyū (1113–1118)" "Gen’ei (1118–1120)" [82] "Hōan (1120–1124)" "Tenji (1124–1126)" "Daiji (1126–1131)" [85] "Tenshō (1131–1132)" "Chōshō (1132–1135)" "Hōen (1135–1141)" [88] "Eiji (1141–1142)" "Kōji (1142–1144)" "Ten’yō (1144–1145)" [91] "Kyūan (1145–1151)" "Ninpei (1151–1154)" "Kyūju (1154–1156)" [94] "Hōgen (1156–1159)" "Heiji (1159–1160)" "Eiryaku (1160–1161)" [97] "Ōho (1161–1163)" "Chōkan (1163–1165)" "Eiman (1165–1166)" [100] "Nin’an (1166–1169)" "Kaō (1169–1171)" "Shōan (1171–1175)" [103] "Angen (1175–1177)" "Jishō (1177–1181)" "Yōwa (1181–1182)" [106] "Juei (1182–1184)" "Genryaku (1184–1185)" "Bunji (1185–1190)" [109] "Kenkyū (1190–1199)" "Shōji (1199–1201)" "Kennin (1201–1204)" [112] "Genkyū (1204–1206)" "Ken’ei (1206–1207)" "Jōgen (1207–1211)" [115] "Kenryaku (1211–1213)" "Kenpō (1213–1219)" "Jōkyū (1219–1222)" [118] "Jōō (1222–1224)" "Gennin (1224–1225)" "Karoku (1225–1227)" [121] "Antei (1227–1229)" "Kanki (1229–1232)" "Jōei (1232–1233)" [124] "Tenpuku (1233–1234)" "Bunryaku (1234–1235)" "Katei (1235–1238)" [127] "Ryakunin (1238–1239)" "En’ō (1239–1240)" "Ninji (1240–1243)" [130] "Kangen (1243–1247)" "Hōji (1247–1249)" "Kenchō (1249–1256)" [133] "Kōgen (1256–1257)" "Shōka (1257–1259)" "Shōgen (1259–1260)" [136] "Bun’ō (1260–1261)" "Kōchō (1261–1264)" "Bun’ei (1264–1275)" [139] "Kenji (1275–1278)" "Kōan (1278–1288)" "Shōō (1288–1293)" [142] "Einin (1293–1299)" "Shōan (1299–1302)" "Kengen (1302–1303)" [145] "Kagen (1303–1306)" "Tokuji (1306–1308)" "Enkyō (1308–1311)" [148] "Ōchō (1311–1312)" "Shōwa (1312–1317)" "Bunpō (1317–1319)" [151] "Genō (1319–1321)" "Genkō (1321–1324)" "Shōchū (1324–1326)" [154] "Karyaku (1326–1329)" "Gentoku (1329–1331)" "Genkō (1331–1334)" [157] "Kenmu (1334–1336)" "Engen (1336–1340)" "Kōkoku (1340–1346)" [160] "Shōhei (1346–1370)" "Kentoku (1370–1372)" "Bunchū (1372–1375)" [163] "Tenju (1375–1379)" "Kōryaku (1379–1381)" "Kōwa (1381–1384)" [166] "Genchū (1384–1392)" "Meitoku (1384–1387)" "Kakei (1387–1389)" [169] "Kōō (1389–1390)" "Meitoku (1390–1394)" "Ōei (1394–1428)" [172] "Shōchō (1428–1429)" "Eikyō (1429–1441)" "Kakitsu (1441–1444)" [175] "Bun’an (1444–1449)" "Hōtoku (1449–1452)" "Kyōtoku (1452–1455)" [178] "Kōshō (1455–1457)" "Chōroku (1457–1460)" "Kanshō (1460–1466)" [181] "Bunshō (1466–1467)" "Ōnin (1467–1469)" "Bunmei (1469–1487)" [184] "Chōkyō (1487–1489)" "Entoku (1489–1492)" "Meiō (1492–1501)" [187] "Bunki (1501–1504)" "Eishō (1504–1521)" "Taiei (1521–1528)" [190] "Kyōroku (1528–1532)" "Tenbun (1532–1555)" "Kōji (1555–1558)" [193] "Eiroku (1558–1570)" "Genki (1570–1573)" "Tenshō (1573–1592)" [196] "Bunroku (1592–1596)" "Keichō (1596–1615)" "Genna (1615–1624)" [199] "Kan’ei (1624–1644)" "Shōho (1644–1648)" "Keian (1648–1652)" [202] "Jōō (1652–1655)" "Meireki (1655–1658)" "Manji (1658–1661)" [205] "Kanbun (1661–1673)" "Enpō (1673–1681)" "Tenna (1681–1684)" [208] "Jōkyō (1684–1688)" "Genroku (1688–1704)" "Hōei (1704–1711)" [211] "Shōtoku (1711–1716)" "Kyōhō (1716–1736)" "Genbun (1736–1741)" [214] "Kanpō (1741–1744)" "Enkyō (1744–1748)" "Kan’en (1748–1751)" [217] "Hōreki (1751–1764)" "Meiwa (1764–1772)" "An’ei (1772–1781)" [220] "Tenmei (1781–1789)" "Kansei (1789–1801)" "Kyōwa (1801–1804)" [223] "Bunka (1804–1818)" "Bunsei (1818–1830)" "Tenpō (1830–1844)" [226] "Kōka (1844–1848)" "Kaei (1848–1854)" "Ansei (1854–1860)" [229] "Man’en (1860–1861)" "Bunkyū (1861–1864)" "Genji (1864–1865)" [232] "Keiō (1865–1868)" "Meiji" "Taishō" [235] "Shōwa" "Heisei" "Reiwa" > > stri_datetime_symbols('ja_JP_TRADITIONAL') # uses the Japanese calendar by default $Month [1] "1月" "2月" "3月" "4月" "5月" "6月" "7月" "8月" "9月" "10月" [11] "11月" "12月" $Weekday [1] "日曜日" "月曜日" "火曜日" "水曜日" "木曜日" "金曜日" "土曜日" $Quarter [1] "第1四半期" "第2四半期" "第3四半期" "第4四半期" $AmPm [1] "午前" "午後" $Era [1] "紀元前" "西暦" > stri_datetime_symbols('th_TH_TRADITIONAL') # uses the Buddhist calendar $Month [1] "มกราคม" "กุมภาพันธ์" "มีนาคม" "เมษายน" "พฤษภาคม" "มิถุนายน" [7] "กรกฎาคม" "สิงหาคม" "กันยายน" "ตุลาคม" "พฤศจิกายน" "ธันวาคม" $Weekday [1] "วันอาทิตย์" "วันจันทร์" "วันอังคาร" "วันพุธ" "วันพฤหัสบดี" "วันศุกร์" "วันเสาร์" $Quarter [1] "ไตรมาส 1" "ไตรมาส 2" "ไตรมาส 3" "ไตรมาส 4" $AmPm [1] "ก่อนเที่ยง" "หลังเที่ยง" $Era [1] "ปีก่อนคริสตกาล" "คริสต์ศักราช" > > stri_datetime_symbols('pl_PL', context='format') $Month [1] "stycznia" "lutego" "marca" "kwietnia" "maja" [6] "czerwca" "lipca" "sierpnia" "września" "października" [11] "listopada" "grudnia" $Weekday [1] "niedziela" "poniedziałek" "wtorek" "środa" "czwartek" [6] "piątek" "sobota" $Quarter [1] "I kwartał" "II kwartał" "III kwartał" "IV kwartał" $AmPm [1] "AM" "PM" $Era [1] "przed naszą erą" "naszej ery" > stri_datetime_symbols('pl_PL', context='standalone') $Month [1] "styczeń" "luty" "marzec" "kwiecień" "maj" [6] "czerwiec" "lipiec" "sierpień" "wrzesień" "październik" [11] "listopad" "grudzień" $Weekday [1] "niedziela" "poniedziałek" "wtorek" "środa" "czwartek" [6] "piątek" "sobota" $Quarter [1] "I kwartał" "II kwartał" "III kwartał" "IV kwartał" $AmPm [1] "AM" "PM" $Era [1] "przed naszą erą" "naszej ery" > > stri_datetime_symbols(width='wide') $Month [1] "January" "February" "March" "April" "May" "June" [7] "July" "August" "September" "October" "November" "December" $Weekday [1] "Sunday" "Monday" "Tuesday" "Wednesday" "Thursday" "Friday" [7] "Saturday" $Quarter [1] "1st quarter" "2nd quarter" "3rd quarter" "4th quarter" $AmPm [1] "am" "pm" $Era [1] "Before Christ" "Anno Domini" > stri_datetime_symbols(width='abbreviated') $Month [1] "Jan" "Feb" "Mar" "Apr" "May" "Jun" "Jul" "Aug" "Sept" "Oct" [11] "Nov" "Dec" $Weekday [1] "Sun" "Mon" "Tue" "Wed" "Thu" "Fri" "Sat" $Quarter [1] "Q1" "Q2" "Q3" "Q4" $AmPm [1] "am" "pm" $Era [1] "BC" "AD" > stri_datetime_symbols(width='narrow') $Month [1] "J" "F" "M" "A" "M" "J" "J" "A" "S" "O" "N" "D" $Weekday [1] "S" "M" "T" "W" "T" "F" "S" $Quarter [1] "1" "2" "3" "4" $AmPm [1] "am" "pm" $Era [1] "B" "A" > > > > > cleanEx() > nameEx("stri_detect") > ### * stri_detect > > flush(stderr()); flush(stdout()) > > ### Name: stri_detect > ### Title: Detect Pattern Occurrences > ### Aliases: stri_detect stri_detect_fixed stri_detect_charclass > ### stri_detect_coll stri_detect_regex > > ### ** Examples > > stri_detect_fixed(c('stringi R', 'R STRINGI', '123'), c('i', 'R', '0')) [1] TRUE TRUE FALSE > stri_detect_fixed(c('stringi R', 'R STRINGI', '123'), 'R') [1] TRUE TRUE FALSE > > stri_detect_charclass(c('stRRRingi','R STRINGI', '123'), + c('\\p{Ll}', '\\p{Lu}', '\\p{Zs}')) [1] TRUE TRUE FALSE > > stri_detect_regex(c('stringi R', 'R STRINGI', '123'), 'R.') [1] FALSE TRUE FALSE > stri_detect_regex(c('stringi R', 'R STRINGI', '123'), '[[:alpha:]]*?') [1] TRUE TRUE TRUE > stri_detect_regex(c('stringi R', 'R STRINGI', '123'), '[a-zC1]') [1] TRUE FALSE TRUE > stri_detect_regex(c('stringi R', 'R STRINGI', '123'), '( R|RE)') [1] TRUE FALSE FALSE > stri_detect_regex('stringi', 'STRING.', case_insensitive=TRUE) [1] TRUE > > stri_detect_regex(c('abc', 'def', '123', 'ghi', '456', '789', 'jkl'), + '^[0-9]+$', max_count=1) [1] FALSE FALSE TRUE NA NA NA NA > stri_detect_regex(c('abc', 'def', '123', 'ghi', '456', '789', 'jkl'), + '^[0-9]+$', max_count=2) [1] FALSE FALSE TRUE FALSE TRUE NA NA > stri_detect_regex(c('abc', 'def', '123', 'ghi', '456', '789', 'jkl'), + '^[0-9]+$', negate=TRUE, max_count=3) [1] TRUE TRUE FALSE TRUE NA NA NA > > > > > cleanEx() > nameEx("stri_dup") > ### * stri_dup > > flush(stderr()); flush(stdout()) > > ### Name: stri_dup > ### Title: Duplicate Strings > ### Aliases: stri_dup operator_multiply oper_multiply %s*% %stri*% > > ### ** Examples > > stri_dup('a', 1:5) [1] "a" "aa" "aaa" "aaaa" "aaaaa" > stri_dup(c('a', NA, 'ba'), 4) [1] "aaaa" NA "babababa" > stri_dup(c('abc', 'pqrst'), c(4, 2)) [1] "abcabcabcabc" "pqrstpqrst" > "a" %s*% 5 [1] "aaaaa" > > > > cleanEx() > nameEx("stri_duplicated") > ### * stri_duplicated > > flush(stderr()); flush(stdout()) > > ### Name: stri_duplicated > ### Title: Determine Duplicated Elements > ### Aliases: stri_duplicated stri_duplicated_any > > ### ** Examples > > # In the following examples, we have 3 duplicated values, > # 'a' - 2 times, NA - 1 time > stri_duplicated(c('a', 'b', 'a', NA, 'a', NA)) [1] FALSE FALSE TRUE FALSE TRUE TRUE > stri_duplicated(c('a', 'b', 'a', NA, 'a', NA), from_last=TRUE) [1] TRUE FALSE TRUE TRUE FALSE FALSE > stri_duplicated_any(c('a', 'b', 'a', NA, 'a', NA)) [1] 3 > > # compare the results: > stri_duplicated(c('\u0105', stri_trans_nfkd('\u0105'))) [1] FALSE TRUE > duplicated(c('\u0105', stri_trans_nfkd('\u0105'))) [1] FALSE FALSE > > stri_duplicated(c('gro\u00df', 'GROSS', 'Gro\u00df', 'Gross'), strength=1) [1] FALSE TRUE TRUE TRUE > duplicated(c('gro\u00df', 'GROSS', 'Gro\u00df', 'Gross')) [1] FALSE FALSE FALSE FALSE > > > > > cleanEx() > nameEx("stri_enc_detect") > ### * stri_enc_detect > > flush(stderr()); flush(stdout()) > > ### Name: stri_enc_detect > ### Title: Detect Character Set and Language > ### Aliases: stri_enc_detect > > ### ** Examples > > ## Not run: > ## f <- rawToChar(readBin('test.txt', 'raw', 100000)) > ## stri_enc_detect(f) > > > > > cleanEx() > nameEx("stri_enc_isascii") > ### * stri_enc_isascii > > flush(stderr()); flush(stdout()) > > ### Name: stri_enc_isascii > ### Title: Check If a Data Stream Is Possibly in ASCII > ### Aliases: stri_enc_isascii > > ### ** Examples > > stri_enc_isascii(letters[1:3]) [1] TRUE TRUE TRUE > stri_enc_isascii('\u0105\u0104') [1] FALSE > > > > > cleanEx() > nameEx("stri_enc_isutf8") > ### * stri_enc_isutf8 > > flush(stderr()); flush(stdout()) > > ### Name: stri_enc_isutf8 > ### Title: Check If a Data Stream Is Possibly in UTF-8 > ### Aliases: stri_enc_isutf8 > > ### ** Examples > > stri_enc_isutf8(letters[1:3]) [1] TRUE TRUE TRUE > stri_enc_isutf8('\u0105\u0104') [1] TRUE > stri_enc_isutf8('\u1234\u0222') [1] TRUE > > > > > cleanEx() > nameEx("stri_enc_list") > ### * stri_enc_list > > flush(stderr()); flush(stdout()) > > ### Name: stri_enc_list > ### Title: List Known Character Encodings > ### Aliases: stri_enc_list > > ### ** Examples > > stri_enc_list() [1] "037" [2] "273" [3] "277" [4] "278" [5] "280" [6] "284" [7] "285" [8] "297" [9] "420" [10] "424" [11] "437" [12] "500" [13] "646" [14] "737" [15] "775" [16] "813" [17] "819" [18] "838" [19] "850" [20] "851" [21] "852" [22] "855" [23] "856" [24] "857" [25] "860" [26] "861" [27] "862" [28] "863" [29] "865" [30] "866" [31] "868" [32] "869" [33] "871" [34] "875" [35] "912" [36] "913" [37] "914" [38] "915" [39] "916" [40] "920" [41] "921" [42] "922" [43] "923" [44] "930" [45] "933" [46] "935" [47] "937" [48] "939" [49] "943" [50] "949" [51] "950" [52] "964" [53] "970" [54] "1006" [55] "1025" [56] "1026" [57] "1047" [58] "1089" [59] "1097" [60] "1098" [61] "1112" [62] "1122" [63] "1123" [64] "1124" [65] "1383" [66] "5601" [67] "8859_1" [68] "8859_2" [69] "8859_3" [70] "8859_4" [71] "8859_5" [72] "8859_6" [73] "8859_7" [74] "8859_8" [75] "8859_9" [76] "8859_13" [77] "8859_15" [78] "33722" [79] "Adobe-Standard-Encoding" [80] "ANSI_X3.4-1968" [81] "ANSI_X3.4-1986" [82] "ANSI1251" [83] "arabic" [84] "ASCII" [85] "ascii7" [86] "ASMO-708" [87] "Big5" [88] "Big5-HKSCS" [89] "big5-hkscs:unicode3.0" [90] "big5hk" [91] "BOCU-1" [92] "CCSID00858" [93] "CCSID01140" [94] "CCSID01141" [95] "CCSID01142" [96] "CCSID01143" [97] "CCSID01144" [98] "CCSID01145" [99] "CCSID01146" [100] "CCSID01147" [101] "CCSID01148" [102] "CCSID01149" [103] "CESU-8" [104] "chinese" [105] "cns11643" [106] "COMPOUND_TEXT" [107] "cp-ar" [108] "cp-gr" [109] "cp-is" [110] "cp037" [111] "cp37" [112] "CP273" [113] "cp277" [114] "cp278" [115] "CP280" [116] "CP284" [117] "CP285" [118] "cp290" [119] "cp297" [120] "cp367" [121] "cp420" [122] "cp424" [123] "cp437" [124] "CP500" [125] "cp737" [126] "cp775" [127] "cp803" [128] "cp813" [129] "cp819" [130] "cp838" [131] "cp850" [132] "cp851" [133] "cp852" [134] "cp855" [135] "cp856" [136] "cp857" [137] "CP00858" [138] "cp858" [139] "cp860" [140] "cp861" [141] "cp862" [142] "cp863" [143] "cp864" [144] "cp865" [145] "cp866" [146] "CP868" [147] "cp869" [148] "CP870" [149] "CP871" [150] "cp874" [151] "cp875" [152] "cp878" [153] "cp912" [154] "cp913" [155] "cp914" [156] "cp915" [157] "cp916" [158] "CP918" [159] "cp920" [160] "cp921" [161] "cp922" [162] "cp923" [163] "cp930" [164] "cp932" [165] "cp933" [166] "cp935" [167] "CP936" [168] "cp937" [169] "cp939" [170] "cp943" [171] "cp943c" [172] "cp949" [173] "cp949c" [174] "cp950" [175] "cp964" [176] "cp970" [177] "cp1006" [178] "cp1025" [179] "CP1026" [180] "cp1047" [181] "cp1089" [182] "cp1097" [183] "cp1098" [184] "cp1112" [185] "cp1122" [186] "cp1123" [187] "cp1124" [188] "cp1125" [189] "cp1131" [190] "CP01140" [191] "cp1140" [192] "CP01141" [193] "cp1141" [194] "CP01142" [195] "cp1142" [196] "CP01143" [197] "cp1143" [198] "CP01144" [199] "cp1144" [200] "CP01145" [201] "cp1145" [202] "CP01146" [203] "cp1146" [204] "CP01147" [205] "cp1147" [206] "CP01148" [207] "cp1148" [208] "CP01149" [209] "cp1149" [210] "cp1200" [211] "cp1201" [212] "cp1208" [213] "cp1250" [214] "cp1251" [215] "cp1252" [216] "cp1253" [217] "cp1254" [218] "cp1255" [219] "cp1256" [220] "cp1257" [221] "cp1258" [222] "cp1363" [223] "cp1383" [224] "cp1386" [225] "cp33722" [226] "cpibm37" [227] "cpibm284" [228] "cpibm285" [229] "cpibm297" [230] "csAdobeStandardEncoding" [231] "csASCII" [232] "csBig5" [233] "csBOCU-1" [234] "csEUCKR" [235] "csEUCPkdFmtJapanese" [236] "csGB2312" [237] "csHPRoman8" [238] "csIBM037" [239] "csIBM273" [240] "csIBM277" [241] "csIBM278" [242] "csIBM280" [243] "csIBM284" [244] "csIBM285" [245] "csIBM290" [246] "csIBM297" [247] "csIBM420" [248] "csIBM424" [249] "csIBM500" [250] "csIBM855" [251] "csIBM857" [252] "csIBM860" [253] "csIBM861" [254] "csIBM863" [255] "csIBM864" [256] "csIBM865" [257] "csIBM866" [258] "csIBM868" [259] "csIBM869" [260] "csIBM870" [261] "csIBM871" [262] "csIBM918" [263] "csIBM1026" [264] "csIBMThai" [265] "csISO58GB231280" [266] "csISO2022CN" [267] "csISO2022JP" [268] "csISO2022JP2" [269] "csISO2022KR" [270] "csisolatin0" [271] "csISOLatin1" [272] "csISOLatin2" [273] "csISOLatin3" [274] "csISOLatin4" [275] "csISOLatin5" [276] "csISOLatin6" [277] "csisolatin9" [278] "csISOLatinArabic" [279] "csISOLatinCyrillic" [280] "csISOLatinGreek" [281] "csISOLatinHebrew" [282] "csJISEncoding" [283] "csKOI8R" [284] "csKSC56011987" [285] "csMacintosh" [286] "csPC8CodePage437" [287] "csPC775Baltic" [288] "csPC850Multilingual" [289] "csPC851" [290] "csPC862LatinHebrew" [291] "csPCp852" [292] "csPCp855" [293] "csShiftJIS" [294] "csUCS4" [295] "csUnicode" [296] "csWindows31J" [297] "cyrillic" [298] "DOS-720" [299] "DOS-862" [300] "ebcdic-ar" [301] "ebcdic-cp-ar1" [302] "ebcdic-cp-ar2" [303] "ebcdic-cp-be" [304] "ebcdic-cp-ca" [305] "ebcdic-cp-ch" [306] "EBCDIC-CP-DK" [307] "ebcdic-cp-es" [308] "ebcdic-cp-fi" [309] "ebcdic-cp-fr" [310] "ebcdic-cp-gb" [311] "ebcdic-cp-he" [312] "ebcdic-cp-is" [313] "ebcdic-cp-it" [314] "ebcdic-cp-nl" [315] "EBCDIC-CP-NO" [316] "ebcdic-cp-roece" [317] "ebcdic-cp-se" [318] "ebcdic-cp-us" [319] "ebcdic-cp-wt" [320] "ebcdic-cp-yu" [321] "ebcdic-de" [322] "ebcdic-de-273+euro" [323] "ebcdic-dk" [324] "ebcdic-dk-277+euro" [325] "ebcdic-es-284+euro" [326] "ebcdic-fi-278+euro" [327] "ebcdic-fr-297+euro" [328] "ebcdic-gb" [329] "ebcdic-gb-285+euro" [330] "ebcdic-he" [331] "ebcdic-international-500+euro" [332] "ebcdic-is" [333] "ebcdic-is-871+euro" [334] "ebcdic-it-280+euro" [335] "EBCDIC-JP-kana" [336] "ebcdic-no-277+euro" [337] "ebcdic-se-278+euro" [338] "ebcdic-sv" [339] "ebcdic-us-37+euro" [340] "ebcdic-xml-us" [341] "ECMA-114" [342] "ECMA-118" [343] "ECMA-128" [344] "ELOT_928" [345] "EUC-CN" [346] "EUC-JP" [347] "euc-jp-2007" [348] "EUC-KR" [349] "EUC-TW" [350] "euc-tw-2014" [351] "eucjis" [352] "eucTH" [353] "Extended_UNIX_Code_Packed_Format_for_Japanese" [354] "GB_2312-80" [355] "GB2312" [356] "gb2312-1980" [357] "GB2312.1980-0" [358] "GB18030" [359] "gb18030-2022" [360] "GBK" [361] "greek" [362] "greek8" [363] "gsm-03.38-2009" [364] "GSM0338" [365] "hebrew" [366] "hebrew8" [367] "hkbig5" [368] "HKSCS-BIG5" [369] "hp-roman8" [370] "hp15CN" [371] "HZ" [372] "HZ-GB-2312" [373] "ibm-37" [374] "ibm-037" [375] "ibm-37_P100-1995" [376] "ibm-37_P100-1995,swaplfnl" [377] "ibm-37-s390" [378] "ibm-273" [379] "ibm-273_P100-1995" [380] "ibm-277" [381] "ibm-277_P100-1995" [382] "ibm-278" [383] "ibm-278_P100-1995" [384] "ibm-280" [385] "ibm-280_P100-1995" [386] "ibm-284" [387] "ibm-284_P100-1995" [388] "ibm-285" [389] "ibm-285_P100-1995" [390] "ibm-290" [391] "ibm-290_P100-1995" [392] "ibm-297" [393] "ibm-297_P100-1995" [394] "ibm-367" [395] "ibm-420" [396] "ibm-420_X120-1999" [397] "ibm-424" [398] "ibm-424_P100-1995" [399] "ibm-437" [400] "ibm-437_P100-1995" [401] "ibm-500" [402] "ibm-500_P100-1995" [403] "ibm-720" [404] "ibm-720_P100-1997" [405] "ibm-737" [406] "ibm-737_P100-1997" [407] "ibm-775" [408] "ibm-775_P100-1996" [409] "ibm-803" [410] "ibm-803_P100-1999" [411] "ibm-813" [412] "ibm-813_P100-1995" [413] "ibm-819" [414] "ibm-838" [415] "ibm-838_P100-1995" [416] "ibm-850" [417] "ibm-850_P100-1995" [418] "ibm-851" [419] "ibm-851_P100-1995" [420] "ibm-852" [421] "ibm-852_P100-1995" [422] "ibm-855" [423] "ibm-855_P100-1995" [424] "ibm-856" [425] "ibm-856_P100-1995" [426] "ibm-857" [427] "ibm-857_P100-1995" [428] "ibm-858" [429] "ibm-858_P100-1997" [430] "ibm-860" [431] "ibm-860_P100-1995" [432] "ibm-861" [433] "ibm-861_P100-1995" [434] "ibm-862" [435] "ibm-862_P100-1995" [436] "ibm-863" [437] "ibm-863_P100-1995" [438] "ibm-864" [439] "ibm-864_X110-1999" [440] "ibm-865" [441] "ibm-865_P100-1995" [442] "ibm-866" [443] "ibm-866_P100-1995" [444] "ibm-867" [445] "ibm-867_P100-1998" [446] "ibm-868" [447] "ibm-868_P100-1995" [448] "ibm-869" [449] "ibm-869_P100-1995" [450] "ibm-870" [451] "ibm-870_P100-1995" [452] "ibm-871" [453] "ibm-871_P100-1995" [454] "ibm-874" [455] "ibm-874_P100-1995" [456] "ibm-875" [457] "ibm-875_P100-1995" [458] "ibm-878" [459] "ibm-878_P100-1996" [460] "ibm-901" [461] "ibm-901_P100-1999" [462] "ibm-902" [463] "ibm-902_P100-1999" [464] "ibm-912" [465] "ibm-912_P100-1995" [466] "ibm-913" [467] "ibm-913_P100-2000" [468] "ibm-914" [469] "ibm-914_P100-1995" [470] "ibm-915" [471] "ibm-915_P100-1995" [472] "ibm-916" [473] "ibm-916_P100-1995" [474] "ibm-918" [475] "ibm-918_P100-1995" [476] "ibm-920" [477] "ibm-920_P100-1995" [478] "ibm-921" [479] "ibm-921_P100-1995" [480] "ibm-922" [481] "ibm-922_P100-1999" [482] "ibm-923" [483] "ibm-923_P100-1998" [484] "ibm-930" [485] "ibm-930_P120-1999" [486] "ibm-931" [487] "ibm-932" [488] "ibm-932_VSUB_VPUA" [489] "ibm-933" [490] "ibm-933_P110-1995" [491] "ibm-935" [492] "ibm-935_P110-1999" [493] "ibm-937" [494] "ibm-937_P110-1999" [495] "ibm-939" [496] "ibm-939_P120-1999" [497] "ibm-942" [498] "ibm-942_P12A-1999" [499] "ibm-942_VSUB_VPUA" [500] "ibm-943" [501] "ibm-943_P15A-2003" [502] "ibm-943_P130-1999" [503] "ibm-943_VASCII_VSUB_VPUA" [504] "ibm-943_VSUB_VPUA" [505] "IBM-943C" [506] "ibm-949" [507] "ibm-949_P11A-1999" [508] "ibm-949_P110-1999" [509] "ibm-949_VASCII_VSUB_VPUA" [510] "ibm-949_VSUB_VPUA" [511] "IBM-949C" [512] "ibm-950" [513] "ibm-950_P110-1999" [514] "ibm-954" [515] "ibm-954_P101-2007" [516] "ibm-964" [517] "ibm-964_P110-1999" [518] "ibm-964_VPUA" [519] "ibm-970" [520] "ibm-970_P110_P110-2006_U2" [521] "ibm-970_VPUA" [522] "ibm-971" [523] "ibm-971_P100-1995" [524] "ibm-971_VPUA" [525] "ibm-1006" [526] "ibm-1006_P100-1995" [527] "ibm-1025" [528] "ibm-1025_P100-1995" [529] "ibm-1026" [530] "ibm-1026_P100-1995" [531] "ibm-1047" [532] "ibm-1047_P100-1995" [533] "ibm-1047_P100-1995,swaplfnl" [534] "ibm-1047-s390" [535] "ibm-1051" [536] "ibm-1051_P100-1995" [537] "ibm-1089" [538] "ibm-1089_P100-1995" [539] "ibm-1097" [540] "ibm-1097_P100-1995" [541] "ibm-1098" [542] "ibm-1098_P100-1995" [543] "ibm-1112" [544] "ibm-1112_P100-1995" [545] "ibm-1122" [546] "ibm-1122_P100-1999" [547] "ibm-1123" [548] "ibm-1123_P100-1995" [549] "ibm-1124" [550] "ibm-1124_P100-1996" [551] "ibm-1125" [552] "ibm-1125_P100-1997" [553] "ibm-1129" [554] "ibm-1129_P100-1997" [555] "ibm-1130" [556] "ibm-1130_P100-1997" [557] "ibm-1131" [558] "ibm-1131_P100-1997" [559] "ibm-1132" [560] "ibm-1132_P100-1998" [561] "ibm-1133" [562] "ibm-1133_P100-1997" [563] "ibm-1137" [564] "ibm-1137_P100-1999" [565] "ibm-1140" [566] "ibm-1140_P100-1997" [567] "ibm-1140_P100-1997,swaplfnl" [568] "ibm-1140-s390" [569] "ibm-1141" [570] "ibm-1141_P100-1997" [571] "ibm-1141_P100-1997,swaplfnl" [572] "ibm-1141-s390" [573] "ibm-1142" [574] "ibm-1142_P100-1997" [575] "ibm-1142_P100-1997,swaplfnl" [576] "ibm-1142-s390" [577] "ibm-1143" [578] "ibm-1143_P100-1997" [579] "ibm-1143_P100-1997,swaplfnl" [580] "ibm-1143-s390" [581] "ibm-1144" [582] "ibm-1144_P100-1997" [583] "ibm-1144_P100-1997,swaplfnl" [584] "ibm-1144-s390" [585] "ibm-1145" [586] "ibm-1145_P100-1997" [587] "ibm-1145_P100-1997,swaplfnl" [588] "ibm-1145-s390" [589] "ibm-1146" [590] "ibm-1146_P100-1997" [591] "ibm-1146_P100-1997,swaplfnl" [592] "ibm-1146-s390" [593] "ibm-1147" [594] "ibm-1147_P100-1997" [595] "ibm-1147_P100-1997,swaplfnl" [596] "ibm-1147-s390" [597] "ibm-1148" [598] "ibm-1148_P100-1997" [599] "ibm-1148_P100-1997,swaplfnl" [600] "ibm-1148-s390" [601] "ibm-1149" [602] "ibm-1149_P100-1997" [603] "ibm-1149_P100-1997,swaplfnl" [604] "ibm-1149-s390" [605] "ibm-1153" [606] "ibm-1153_P100-1999" [607] "ibm-1153_P100-1999,swaplfnl" [608] "ibm-1153-s390" [609] "ibm-1154" [610] "ibm-1154_P100-1999" [611] "ibm-1155" [612] "ibm-1155_P100-1999" [613] "ibm-1156" [614] "ibm-1156_P100-1999" [615] "ibm-1157" [616] "ibm-1157_P100-1999" [617] "ibm-1158" [618] "ibm-1158_P100-1999" [619] "ibm-1160" [620] "ibm-1160_P100-1999" [621] "ibm-1162" [622] "ibm-1162_P100-1999" [623] "ibm-1164" [624] "ibm-1164_P100-1999" [625] "ibm-1168" [626] "ibm-1168_P100-2002" [627] "ibm-1200" [628] "ibm-1201" [629] "ibm-1202" [630] "ibm-1203" [631] "ibm-1204" [632] "ibm-1205" [633] "ibm-1208" [634] "ibm-1209" [635] "ibm-1212" [636] "ibm-1213" [637] "ibm-1214" [638] "ibm-1215" [639] "ibm-1232" [640] "ibm-1233" [641] "ibm-1234" [642] "ibm-1235" [643] "ibm-1236" [644] "ibm-1237" [645] "ibm-1250" [646] "ibm-1250_P100-1995" [647] "ibm-1251" [648] "ibm-1251_P100-1995" [649] "ibm-1252" [650] "ibm-1252_P100-2000" [651] "ibm-1253" [652] "ibm-1253_P100-1995" [653] "ibm-1254" [654] "ibm-1254_P100-1995" [655] "ibm-1255" [656] "ibm-1255_P100-1995" [657] "ibm-1256" [658] "ibm-1256_P110-1997" [659] "ibm-1257" [660] "ibm-1257_P100-1995" [661] "ibm-1258" [662] "ibm-1258_P100-1997" [663] "ibm-1276" [664] "ibm-1276_P100-1995" [665] "ibm-1363" [666] "ibm-1363_P11B-1998" [667] "ibm-1363_P110-1997" [668] "ibm-1363_VASCII_VSUB_VPUA" [669] "ibm-1363_VSUB_VPUA" [670] "ibm-1364" [671] "ibm-1364_P110-2007" [672] "ibm-1371" [673] "ibm-1371_P100-1999" [674] "ibm-1373" [675] "ibm-1373_P100-2002" [676] "ibm-1375" [677] "ibm-1375_P100-2008" [678] "ibm-1383" [679] "ibm-1383_P110-1999" [680] "ibm-1383_VPUA" [681] "ibm-1386" [682] "ibm-1386_P100-2001" [683] "ibm-1386_VSUB_VPUA" [684] "ibm-1388" [685] "ibm-1388_P103-2001" [686] "ibm-1390" [687] "ibm-1390_P110-2003" [688] "ibm-1392" [689] "ibm-1399" [690] "ibm-1399_P110-2003" [691] "ibm-4517" [692] "ibm-4517_P100-2005" [693] "ibm-4899" [694] "ibm-4899_P100-1998" [695] "ibm-4902" [696] "ibm-4909" [697] "ibm-4909_P100-1999" [698] "ibm-4971" [699] "ibm-4971_P100-1999" [700] "ibm-5012" [701] "ibm-5012_P100-1999" [702] "ibm-5026" [703] "ibm-5035" [704] "ibm-5050" [705] "ibm-5054" [706] "ibm-5123" [707] "ibm-5123_P100-1999" [708] "ibm-5304" [709] "ibm-5305" [710] "ibm-5346" [711] "ibm-5346_P100-1998" [712] "ibm-5347" [713] "ibm-5347_P100-1998" [714] "ibm-5348" [715] "ibm-5348_P100-1997" [716] "ibm-5349" [717] "ibm-5349_P100-1998" [718] "ibm-5350" [719] "ibm-5350_P100-1998" [720] "ibm-5351" [721] "ibm-5351_P100-1998" [722] "ibm-5352" [723] "ibm-5352_P100-1998" [724] "ibm-5353" [725] "ibm-5353_P100-1998" [726] "ibm-5354" [727] "ibm-5354_P100-1998" [728] "ibm-5471" [729] "ibm-5471_P100-2006" [730] "ibm-5478" [731] "ibm-5478_P100-1995" [732] "ibm-8482" [733] "ibm-8482_P100-1999" [734] "ibm-9005" [735] "ibm-9005_X110-2007" [736] "ibm-9030" [737] "ibm-9066" [738] "ibm-9067" [739] "ibm-9067_X100-2005" [740] "ibm-9400" [741] "ibm-9424" [742] "ibm-9447" [743] "ibm-9447_P100-2002" [744] "ibm-9448" [745] "ibm-9448_X100-2005" [746] "ibm-9449" [747] "ibm-9449_P100-2002" [748] "ibm-9580" [749] "ibm-12712" [750] "ibm-12712_P100-1998" [751] "ibm-12712_P100-1998,swaplfnl" [752] "ibm-12712-s390" [753] "ibm-13488" [754] "ibm-13489" [755] "ibm-13490" [756] "ibm-13491" [757] "ibm-13496" [758] "ibm-13497" [759] "ibm-16684" [760] "ibm-16684_P110-2003" [761] "ibm-16804" [762] "ibm-16804_X110-1999" [763] "ibm-16804_X110-1999,swaplfnl" [764] "ibm-16804-s390" [765] "ibm-17584" [766] "ibm-17585" [767] "ibm-17586" [768] "ibm-17587" [769] "ibm-17592" [770] "ibm-17593" [771] "ibm-20780" [772] "ibm-21680" [773] "ibm-21681" [774] "ibm-21682" [775] "ibm-21683" [776] "ibm-25546" [777] "ibm-25776" [778] "ibm-25777" [779] "ibm-25778" [780] "ibm-25779" [781] "ibm-29872" [782] "ibm-29873" [783] "ibm-29874" [784] "ibm-29875" [785] "ibm-33722" [786] "ibm-33722_P12A_P12A-2009_U2" [787] "ibm-33722_P120-1999" [788] "ibm-33722_VASCII_VPUA" [789] "ibm-33722_VPUA" [790] "ibm-61955" [791] "ibm-61956" [792] "ibm-65025" [793] "ibm-eucCN" [794] "IBM-eucJP" [795] "ibm-eucKR" [796] "ibm-eucTW" [797] "IBM-Thai" [798] "IBM037" [799] "IBM273" [800] "IBM277" [801] "IBM278" [802] "IBM280" [803] "IBM284" [804] "IBM285" [805] "IBM290" [806] "IBM297" [807] "IBM367" [808] "IBM420" [809] "IBM424" [810] "IBM437" [811] "IBM500" [812] "IBM737" [813] "IBM775" [814] "IBM819" [815] "IBM838" [816] "IBM850" [817] "IBM851" [818] "IBM852" [819] "IBM855" [820] "IBM856" [821] "IBM857" [822] "IBM00858" [823] "IBM860" [824] "IBM861" [825] "IBM862" [826] "IBM863" [827] "IBM864" [828] "IBM865" [829] "IBM866" [830] "IBM868" [831] "IBM869" [832] "IBM870" [833] "IBM871" [834] "IBM875" [835] "IBM918" [836] "IBM922" [837] "IBM930" [838] "IBM939" [839] "IBM1006" [840] "IBM1026" [841] "IBM1047" [842] "IBM1047_LF" [843] "IBM1098" [844] "IBM01140" [845] "IBM01141" [846] "IBM1141_LF" [847] "IBM01142" [848] "IBM01143" [849] "IBM01144" [850] "IBM01145" [851] "IBM01146" [852] "IBM01147" [853] "IBM01148" [854] "IBM01149" [855] "IBM1153" [856] "IMAP-mailbox-name" [857] "iscii-bng" [858] "iscii-dev" [859] "iscii-guj" [860] "iscii-gur" [861] "iscii-knd" [862] "iscii-mlm" [863] "iscii-ori" [864] "iscii-tlg" [865] "iscii-tml" [866] "ISCII,version=0" [867] "ISCII,version=1" [868] "ISCII,version=2" [869] "ISCII,version=3" [870] "ISCII,version=4" [871] "ISCII,version=5" [872] "ISCII,version=6" [873] "ISCII,version=7" [874] "ISCII,version=8" [875] "iso_646.irv:1983" [876] "ISO_646.irv:1991" [877] "ISO_2022,locale=ja,version=0" [878] "ISO_2022,locale=ja,version=1" [879] "ISO_2022,locale=ja,version=2" [880] "ISO_2022,locale=ja,version=3" [881] "ISO_2022,locale=ja,version=4" [882] "ISO_2022,locale=ko,version=0" [883] "ISO_2022,locale=ko,version=1" [884] "ISO_2022,locale=zh,version=0" [885] "ISO_2022,locale=zh,version=1" [886] "ISO_2022,locale=zh,version=2" [887] "ISO_8859-1:1987" [888] "ISO_8859-2:1987" [889] "ISO_8859-3:1988" [890] "ISO_8859-4:1988" [891] "ISO_8859-5:1988" [892] "ISO_8859-6:1987" [893] "ISO_8859-7:1987" [894] "ISO_8859-8:1988" [895] "ISO_8859-9:1989" [896] "ISO_8859-10:1992" [897] "ISO_8859-14:1998" [898] "ISO-2022-CN" [899] "ISO-2022-CN-CNS" [900] "ISO-2022-CN-EXT" [901] "ISO-2022-JP" [902] "ISO-2022-JP-1" [903] "ISO-2022-JP-2" [904] "ISO-2022-KR" [905] "iso-8859_10-1998" [906] "iso-8859_11-2001" [907] "iso-8859_14-1998" [908] "ISO-8859-1" [909] "ISO-8859-2" [910] "ISO-8859-3" [911] "ISO-8859-4" [912] "ISO-8859-5" [913] "ISO-8859-6" [914] "ISO-8859-6-E" [915] "ISO-8859-6-I" [916] "ISO-8859-7" [917] "ISO-8859-8" [918] "ISO-8859-8-E" [919] "ISO-8859-8-I" [920] "ISO-8859-9" [921] "ISO-8859-10" [922] "ISO-8859-11" [923] "ISO-8859-13" [924] "ISO-8859-14" [925] "ISO-8859-15" [926] "ISO-10646-UCS-2" [927] "ISO-10646-UCS-4" [928] "iso-celtic" [929] "iso-ir-6" [930] "iso-ir-58" [931] "iso-ir-100" [932] "iso-ir-101" [933] "iso-ir-109" [934] "iso-ir-110" [935] "iso-ir-126" [936] "iso-ir-127" [937] "iso-ir-138" [938] "iso-ir-144" [939] "iso-ir-148" [940] "iso-ir-149" [941] "iso-ir-157" [942] "iso-ir-199" [943] "ISO646-US" [944] "iso8859_15_fdis" [945] "JIS" [946] "JIS_Encoding" [947] "JIS7" [948] "JIS8" [949] "koi8" [950] "KOI8-R" [951] "KOI8-U" [952] "korean" [953] "KS_C_5601-1987" [954] "KS_C_5601-1989" [955] "ksc" [956] "KSC_5601" [957] "l1" [958] "l2" [959] "l3" [960] "l4" [961] "l5" [962] "l6" [963] "l8" [964] "l9" [965] "Latin-9" [966] "latin0" [967] "latin1" [968] "latin2" [969] "latin3" [970] "latin4" [971] "latin5" [972] "latin6" [973] "latin8" [974] "lmbcs" [975] "LMBCS-1" [976] "mac" [977] "mac-cyrillic" [978] "macce" [979] "maccentraleurope" [980] "maccy" [981] "macgr" [982] "macintosh" [983] "macos-0_2-10.2" [984] "macos-6_2-10.4" [985] "macos-7_3-10.2" [986] "macos-29-10.2" [987] "macos-35-10.2" [988] "macroman" [989] "mactr" [990] "MS_Kanji" [991] "MS874" [992] "ms932" [993] "MS936" [994] "ms949" [995] "ms950" [996] "MS950_HKSCS" [997] "PC-Multilingual-850+euro" [998] "pck" [999] "r8" [1000] "roman8" [1001] "SCSU" [1002] "Shift_JIS" [1003] "shift_jis78" [1004] "sjis" [1005] "sjis78" [1006] "sun_eu_greek" [1007] "thai8" [1008] "TIS-620" [1009] "tis620.2533" [1010] "turkish" [1011] "turkish8" [1012] "ucs-2" [1013] "ucs-4" [1014] "ujis" [1015] "unicode" [1016] "unicode-1-1-utf-7" [1017] "unicode-1-1-utf-8" [1018] "unicode-2-0-utf-7" [1019] "unicode-2-0-utf-8" [1020] "UnicodeBig" [1021] "UnicodeBigUnmarked" [1022] "UnicodeLittle" [1023] "UnicodeLittleUnmarked" [1024] "us" [1025] "US-ASCII" [1026] "UTF-7" [1027] "UTF-8" [1028] "UTF-16" [1029] "UTF-16,version=1" [1030] "UTF-16,version=2" [1031] "UTF-16BE" [1032] "UTF-16BE,version=1" [1033] "UTF-16LE" [1034] "UTF-16LE,version=1" [1035] "UTF-32" [1036] "UTF-32BE" [1037] "UTF-32LE" [1038] "UTF16_BigEndian" [1039] "UTF16_LittleEndian" [1040] "UTF16_OppositeEndian" [1041] "UTF16_PlatformEndian" [1042] "UTF32_BigEndian" [1043] "UTF32_LittleEndian" [1044] "UTF32_OppositeEndian" [1045] "UTF32_PlatformEndian" [1046] "windows-31j" [1047] "windows-437" [1048] "windows-720" [1049] "windows-737" [1050] "windows-775" [1051] "windows-850" [1052] "windows-852" [1053] "windows-855" [1054] "windows-857" [1055] "windows-858" [1056] "windows-861" [1057] "windows-862" [1058] "windows-866" [1059] "windows-869" [1060] "windows-874" [1061] "windows-874-2000" [1062] "windows-932" [1063] "windows-936" [1064] "windows-936-2000" [1065] "windows-949" [1066] "windows-949-2000" [1067] "windows-950" [1068] "windows-950-2000" [1069] "windows-1200" [1070] "windows-1201" [1071] "windows-1250" [1072] "windows-1251" [1073] "windows-1252" [1074] "windows-1253" [1075] "windows-1254" [1076] "windows-1255" [1077] "windows-1256" [1078] "windows-1257" [1079] "windows-1258" [1080] "windows-10000" [1081] "windows-10006" [1082] "windows-10007" [1083] "windows-10029" [1084] "windows-10081" [1085] "windows-20127" [1086] "windows-20866" [1087] "windows-21866" [1088] "windows-28592" [1089] "windows-28593" [1090] "windows-28594" [1091] "windows-28595" [1092] "windows-28596" [1093] "windows-28597" [1094] "windows-28598" [1095] "windows-28599" [1096] "windows-28603" [1097] "windows-28605" [1098] "windows-51949" [1099] "windows-54936" [1100] "windows-57002" [1101] "windows-57003" [1102] "windows-57004" [1103] "windows-57005" [1104] "windows-57006" [1105] "windows-57007" [1106] "windows-57008" [1107] "windows-57009" [1108] "windows-57010" [1109] "windows-57011" [1110] "windows-65000" [1111] "windows-65001" [1112] "x-big5" [1113] "x-compound-text" [1114] "X-EUC-JP" [1115] "x-IBM720" [1116] "x-IBM737" [1117] "x-IBM856" [1118] "x-IBM867" [1119] "x-IBM874" [1120] "x-IBM875" [1121] "x-IBM921" [1122] "x-IBM922" [1123] "x-IBM930" [1124] "x-IBM930A" [1125] "x-IBM933" [1126] "x-IBM935" [1127] "x-IBM937" [1128] "x-IBM939" [1129] "x-IBM939A" [1130] "x-IBM942" [1131] "x-IBM942C" [1132] "x-IBM943" [1133] "x-IBM949" [1134] "x-IBM949C" [1135] "x-IBM950" [1136] "x-IBM954" [1137] "x-IBM954C" [1138] "x-IBM964" [1139] "x-IBM970" [1140] "x-IBM971" [1141] "x-IBM1006" [1142] "x-IBM1025" [1143] "x-IBM1097" [1144] "x-IBM1098" [1145] "x-IBM1112" [1146] "x-IBM1122" [1147] "x-IBM1123" [1148] "x-IBM1124" [1149] "x-IBM1153" [1150] "x-IBM1363" [1151] "x-IBM1363C" [1152] "x-IBM1364" [1153] "x-IBM1371" [1154] "x-IBM1388" [1155] "x-IBM1390" [1156] "x-IBM1399" [1157] "x-IBM33722" [1158] "x-IBM33722A" [1159] "x-IBM33722C" [1160] "x-iscii-as" [1161] "x-iscii-be" [1162] "x-iscii-de" [1163] "x-iscii-gu" [1164] "x-iscii-ka" [1165] "x-iscii-ma" [1166] "x-iscii-or" [1167] "x-iscii-pa" [1168] "x-iscii-ta" [1169] "x-iscii-te" [1170] "x-ISCII91" [1171] "x-ISO-2022-CN-CNS" [1172] "x-ISO-2022-CN-GB" [1173] "x-ISO-8859-6S" [1174] "x-iso-8859-11" [1175] "x-JISAutoDetect" [1176] "x-KSC5601" [1177] "x-mac-ce" [1178] "x-mac-centraleurroman" [1179] "x-mac-cyrillic" [1180] "x-mac-greek" [1181] "x-mac-turkish" [1182] "x-MacCentralEurope" [1183] "x-MacCyrillic" [1184] "x-MacGreek" [1185] "x-macroman" [1186] "x-MacTurkish" [1187] "x-MacUkraine" [1188] "x-ms-cp932" [1189] "x-MS932_0213" [1190] "x-MS950-HKSCS" [1191] "x-roman8" [1192] "x-sjis" [1193] "x-UTF_8J" [1194] "x-utf-16be" [1195] "x-utf-16le" [1196] "x-UTF-16LE-BOM" [1197] "x-windows-874" [1198] "x-windows-950" [1199] "x-windows-1256S" [1200] "x-windows-50220" [1201] "x-windows-50221" [1202] "x-windows-iso2022jp" [1203] "x11-compound-text" > stri_enc_list(FALSE) $`BOCU-1` [1] "BOCU-1" "csBOCU-1" "ibm-1214" "ibm-1215" $`CESU-8` [1] "CESU-8" "ibm-9400" $`ebcdic-xml-us` [1] "ebcdic-xml-us" $`euc-jp-2007` [1] "csEUCPkdFmtJapanese" [2] "EUC-JP" [3] "euc-jp-2007" [4] "eucjis" [5] "Extended_UNIX_Code_Packed_Format_for_Japanese" [6] "ujis" [7] "X-EUC-JP" $`euc-tw-2014` [1] "EUC-TW" "euc-tw-2014" $`gb18030-2022` [1] "GB18030" "gb18030-2022" "ibm-1392" "windows-54936" $`gsm-03.38-2009` [1] "gsm-03.38-2009" "GSM0338" $HZ [1] "HZ" "HZ-GB-2312" $`ibm-37_P100-1995` [1] "037" "cp037" "cp37" "cpibm37" [5] "csIBM037" "ebcdic-cp-ca" "ebcdic-cp-nl" "ebcdic-cp-us" [9] "ebcdic-cp-wt" "ibm-37" "ibm-037" "ibm-37_P100-1995" [13] "IBM037" $`ibm-37_P100-1995,swaplfnl` [1] "ibm-37_P100-1995,swaplfnl" "ibm-37-s390" $`ibm-273_P100-1995` [1] "273" "CP273" "csIBM273" [4] "ebcdic-de" "ibm-273" "ibm-273_P100-1995" [7] "IBM273" $`ibm-277_P100-1995` [1] "277" "cp277" "csIBM277" [4] "EBCDIC-CP-DK" "EBCDIC-CP-NO" "ebcdic-dk" [7] "ibm-277" "ibm-277_P100-1995" "IBM277" $`ibm-278_P100-1995` [1] "278" "cp278" "csIBM278" [4] "ebcdic-cp-fi" "ebcdic-cp-se" "ebcdic-sv" [7] "ibm-278" "ibm-278_P100-1995" "IBM278" $`ibm-280_P100-1995` [1] "280" "CP280" "csIBM280" [4] "ebcdic-cp-it" "ibm-280" "ibm-280_P100-1995" [7] "IBM280" $`ibm-284_P100-1995` [1] "284" "CP284" "cpibm284" [4] "csIBM284" "ebcdic-cp-es" "ibm-284" [7] "ibm-284_P100-1995" "IBM284" $`ibm-285_P100-1995` [1] "285" "CP285" "cpibm285" [4] "csIBM285" "ebcdic-cp-gb" "ebcdic-gb" [7] "ibm-285" "ibm-285_P100-1995" "IBM285" $`ibm-290_P100-1995` [1] "cp290" "csIBM290" "EBCDIC-JP-kana" [4] "ibm-290" "ibm-290_P100-1995" "IBM290" $`ibm-297_P100-1995` [1] "297" "cp297" "cpibm297" [4] "csIBM297" "ebcdic-cp-fr" "ibm-297" [7] "ibm-297_P100-1995" "IBM297" $`ibm-420_X120-1999` [1] "420" "cp420" "csIBM420" [4] "ebcdic-cp-ar1" "ibm-420" "ibm-420_X120-1999" [7] "IBM420" $`ibm-424_P100-1995` [1] "424" "cp424" "csIBM424" [4] "ebcdic-cp-he" "ibm-424" "ibm-424_P100-1995" [7] "IBM424" $`ibm-437_P100-1995` [1] "437" "cp437" "csPC8CodePage437" [4] "ibm-437" "ibm-437_P100-1995" "IBM437" [7] "windows-437" $`ibm-500_P100-1995` [1] "500" "CP500" "csIBM500" [4] "ebcdic-cp-be" "ebcdic-cp-ch" "ibm-500" [7] "ibm-500_P100-1995" "IBM500" $`ibm-720_P100-1997` [1] "DOS-720" "ibm-720" "ibm-720_P100-1997" [4] "windows-720" "x-IBM720" $`ibm-737_P100-1997` [1] "737" "cp737" "ibm-737" [4] "ibm-737_P100-1997" "IBM737" "windows-737" [7] "x-IBM737" $`ibm-775_P100-1996` [1] "775" "cp775" "csPC775Baltic" [4] "ibm-775" "ibm-775_P100-1996" "IBM775" [7] "windows-775" $`ibm-803_P100-1999` [1] "cp803" "ibm-803" "ibm-803_P100-1999" $`ibm-813_P100-1995` [1] "813" "cp813" "ibm-813" [4] "ibm-813_P100-1995" $`ibm-838_P100-1995` [1] "838" "cp838" "csIBMThai" [4] "ibm-838" "ibm-838_P100-1995" "ibm-9030" [7] "IBM-Thai" "IBM838" $`ibm-850_P100-1995` [1] "850" "cp850" "csPC850Multilingual" [4] "ibm-850" "ibm-850_P100-1995" "IBM850" [7] "windows-850" $`ibm-851_P100-1995` [1] "851" "cp851" "csPC851" [4] "ibm-851" "ibm-851_P100-1995" "IBM851" $`ibm-852_P100-1995` [1] "852" "cp852" "csPCp852" [4] "ibm-852" "ibm-852_P100-1995" "IBM852" [7] "windows-852" $`ibm-855_P100-1995` [1] "855" "cp855" "csIBM855" [4] "csPCp855" "ibm-855" "ibm-855_P100-1995" [7] "IBM855" "windows-855" $`ibm-856_P100-1995` [1] "856" "cp856" "ibm-856" [4] "ibm-856_P100-1995" "IBM856" "x-IBM856" $`ibm-857_P100-1995` [1] "857" "cp857" "csIBM857" [4] "ibm-857" "ibm-857_P100-1995" "IBM857" [7] "windows-857" $`ibm-858_P100-1997` [1] "CCSID00858" "CP00858" [3] "cp858" "ibm-858" [5] "ibm-858_P100-1997" "IBM00858" [7] "PC-Multilingual-850+euro" "windows-858" $`ibm-860_P100-1995` [1] "860" "cp860" "csIBM860" [4] "ibm-860" "ibm-860_P100-1995" "IBM860" $`ibm-861_P100-1995` [1] "861" "cp-is" "cp861" [4] "csIBM861" "ibm-861" "ibm-861_P100-1995" [7] "IBM861" "windows-861" $`ibm-862_P100-1995` [1] "862" "cp862" "csPC862LatinHebrew" [4] "DOS-862" "ibm-862" "ibm-862_P100-1995" [7] "IBM862" "windows-862" $`ibm-863_P100-1995` [1] "863" "cp863" "csIBM863" [4] "ibm-863" "ibm-863_P100-1995" "IBM863" $`ibm-864_X110-1999` [1] "cp864" "csIBM864" "ibm-864" [4] "ibm-864_X110-1999" "IBM864" $`ibm-865_P100-1995` [1] "865" "cp865" "csIBM865" [4] "ibm-865" "ibm-865_P100-1995" "IBM865" $`ibm-866_P100-1995` [1] "866" "cp866" "csIBM866" [4] "ibm-866" "ibm-866_P100-1995" "IBM866" [7] "windows-866" $`ibm-867_P100-1998` [1] "ibm-867" "ibm-867_P100-1998" "x-IBM867" $`ibm-868_P100-1995` [1] "868" "cp-ar" "CP868" [4] "csIBM868" "ibm-868" "ibm-868_P100-1995" [7] "IBM868" $`ibm-869_P100-1995` [1] "869" "cp-gr" "cp869" [4] "csIBM869" "ibm-869" "ibm-869_P100-1995" [7] "IBM869" "windows-869" $`ibm-870_P100-1995` [1] "CP870" "csIBM870" "ebcdic-cp-roece" [4] "ebcdic-cp-yu" "ibm-870" "ibm-870_P100-1995" [7] "IBM870" $`ibm-871_P100-1995` [1] "871" "CP871" "csIBM871" [4] "ebcdic-cp-is" "ebcdic-is" "ibm-871" [7] "ibm-871_P100-1995" "IBM871" $`ibm-874_P100-1995` [1] "cp874" "eucTH" "ibm-874" [4] "ibm-874_P100-1995" "ibm-9066" "TIS-620" [7] "tis620.2533" "x-IBM874" $`ibm-875_P100-1995` [1] "875" "cp875" "ibm-875" [4] "ibm-875_P100-1995" "IBM875" "x-IBM875" $`ibm-878_P100-1996` [1] "cp878" "csKOI8R" "ibm-878" [4] "ibm-878_P100-1996" "koi8" "KOI8-R" [7] "windows-20866" $`ibm-901_P100-1999` [1] "ibm-901" "ibm-901_P100-1999" $`ibm-902_P100-1999` [1] "ibm-902" "ibm-902_P100-1999" $`ibm-912_P100-1995` [1] "912" "8859_2" "cp912" [4] "csISOLatin2" "ibm-912" "ibm-912_P100-1995" [7] "ISO_8859-2:1987" "ISO-8859-2" "iso-ir-101" [10] "l2" "latin2" "windows-28592" $`ibm-913_P100-2000` [1] "913" "8859_3" "cp913" [4] "csISOLatin3" "ibm-913" "ibm-913_P100-2000" [7] "ISO_8859-3:1988" "ISO-8859-3" "iso-ir-109" [10] "l3" "latin3" "windows-28593" $`ibm-914_P100-1995` [1] "914" "8859_4" "cp914" [4] "csISOLatin4" "ibm-914" "ibm-914_P100-1995" [7] "ISO_8859-4:1988" "ISO-8859-4" "iso-ir-110" [10] "l4" "latin4" "windows-28594" $`ibm-915_P100-1995` [1] "915" "8859_5" "cp915" [4] "csISOLatinCyrillic" "cyrillic" "ibm-915" [7] "ibm-915_P100-1995" "ISO_8859-5:1988" "ISO-8859-5" [10] "iso-ir-144" "windows-28595" $`ibm-916_P100-1995` [1] "916" "cp916" "ibm-916" [4] "ibm-916_P100-1995" $`ibm-918_P100-1995` [1] "CP918" "csIBM918" "ebcdic-cp-ar2" [4] "ibm-918" "ibm-918_P100-1995" "IBM918" $`ibm-920_P100-1995` [1] "920" "8859_9" "cp920" [4] "csISOLatin5" "ECMA-128" "ibm-920" [7] "ibm-920_P100-1995" "ISO_8859-9:1989" "ISO-8859-9" [10] "iso-ir-148" "l5" "latin5" [13] "turkish" "turkish8" "windows-28599" $`ibm-921_P100-1995` [1] "921" "8859_13" "cp921" [4] "ibm-921" "ibm-921_P100-1995" "ISO-8859-13" [7] "windows-28603" "x-IBM921" $`ibm-922_P100-1999` [1] "922" "cp922" "ibm-922" [4] "ibm-922_P100-1999" "IBM922" "x-IBM922" $`ibm-923_P100-1998` [1] "923" "8859_15" "cp923" [4] "csisolatin0" "csisolatin9" "ibm-923" [7] "ibm-923_P100-1998" "ISO-8859-15" "iso8859_15_fdis" [10] "l9" "Latin-9" "latin0" [13] "windows-28605" $`ibm-930_P120-1999` [1] "930" "cp930" "ibm-930" [4] "ibm-930_P120-1999" "ibm-5026" "IBM930" [7] "x-IBM930" "x-IBM930A" $`ibm-933_P110-1995` [1] "933" "cp933" "ibm-933" [4] "ibm-933_P110-1995" "x-IBM933" $`ibm-935_P110-1999` [1] "935" "cp935" "ibm-935" [4] "ibm-935_P110-1999" "x-IBM935" $`ibm-937_P110-1999` [1] "937" "cp937" "ibm-937" [4] "ibm-937_P110-1999" "x-IBM937" $`ibm-939_P120-1999` [1] "939" "cp939" "ibm-931" [4] "ibm-939" "ibm-939_P120-1999" "ibm-5035" [7] "IBM939" "x-IBM939" "x-IBM939A" $`ibm-942_P12A-1999` [1] "cp932" "ibm-932" "ibm-932_VSUB_VPUA" [4] "ibm-942" "ibm-942_P12A-1999" "ibm-942_VSUB_VPUA" [7] "shift_jis78" "sjis78" "x-IBM942" [10] "x-IBM942C" $`ibm-943_P15A-2003` [1] "cp932" "cp943c" "csShiftJIS" [4] "csWindows31J" "ibm-943" "ibm-943_P15A-2003" [7] "ibm-943_VSUB_VPUA" "IBM-943C" "MS_Kanji" [10] "ms932" "pck" "Shift_JIS" [13] "sjis" "windows-31j" "windows-932" [16] "x-JISAutoDetect" "x-ms-cp932" "x-MS932_0213" [19] "x-sjis" $`ibm-943_P130-1999` [1] "943" "cp943" [3] "ibm-943" "ibm-943_P130-1999" [5] "ibm-943_VASCII_VSUB_VPUA" "Shift_JIS" [7] "x-IBM943" $`ibm-949_P11A-1999` [1] "cp949c" "ibm-949" "ibm-949_P11A-1999" [4] "ibm-949_VSUB_VPUA" "IBM-949C" "x-IBM949C" $`ibm-949_P110-1999` [1] "949" "cp949" [3] "ibm-949" "ibm-949_P110-1999" [5] "ibm-949_VASCII_VSUB_VPUA" "x-IBM949" $`ibm-950_P110-1999` [1] "950" "cp950" "ibm-950" [4] "ibm-950_P110-1999" "x-IBM950" $`ibm-954_P101-2007` [1] "ibm-954" "ibm-954_P101-2007" "x-IBM954" [4] "x-IBM954C" $`ibm-964_P110-1999` [1] "964" "cns11643" "cp964" [4] "ibm-964" "ibm-964_P110-1999" "ibm-964_VPUA" [7] "ibm-eucTW" "x-IBM964" $`ibm-970_P110_P110-2006_U2` [1] "970" "5601" [3] "cp970" "csEUCKR" [5] "EUC-KR" "ibm-970" [7] "ibm-970_P110_P110-2006_U2" "ibm-970_VPUA" [9] "ibm-eucKR" "KS_C_5601-1987" [11] "KSC_5601" "windows-51949" [13] "x-IBM970" $`ibm-971_P100-1995` [1] "ibm-971" "ibm-971_P100-1995" "ibm-971_VPUA" [4] "x-IBM971" $`ibm-1006_P100-1995` [1] "1006" "cp1006" "ibm-1006" [4] "ibm-1006_P100-1995" "IBM1006" "x-IBM1006" $`ibm-1025_P100-1995` [1] "1025" "cp1025" "ibm-1025" [4] "ibm-1025_P100-1995" "x-IBM1025" $`ibm-1026_P100-1995` [1] "1026" "CP1026" "csIBM1026" [4] "ibm-1026" "ibm-1026_P100-1995" "IBM1026" $`ibm-1047_P100-1995` [1] "1047" "cp1047" "ibm-1047" [4] "ibm-1047_P100-1995" "IBM1047" $`ibm-1047_P100-1995,swaplfnl` [1] "ibm-1047_P100-1995,swaplfnl" "ibm-1047-s390" [3] "IBM1047_LF" $`ibm-1051_P100-1995` [1] "csHPRoman8" "hp-roman8" "ibm-1051" [4] "ibm-1051_P100-1995" "r8" "roman8" [7] "x-roman8" $`ibm-1089_P100-1995` [1] "1089" "8859_6" "arabic" [4] "ASMO-708" "cp1089" "csISOLatinArabic" [7] "ECMA-114" "ibm-1089" "ibm-1089_P100-1995" [10] "ISO_8859-6:1987" "ISO-8859-6" "ISO-8859-6-E" [13] "ISO-8859-6-I" "iso-ir-127" "windows-28596" [16] "x-ISO-8859-6S" $`ibm-1097_P100-1995` [1] "1097" "cp1097" "ibm-1097" [4] "ibm-1097_P100-1995" "x-IBM1097" $`ibm-1098_P100-1995` [1] "1098" "cp1098" "ibm-1098" [4] "ibm-1098_P100-1995" "IBM1098" "x-IBM1098" $`ibm-1112_P100-1995` [1] "1112" "cp1112" "ibm-1112" [4] "ibm-1112_P100-1995" "x-IBM1112" $`ibm-1122_P100-1999` [1] "1122" "cp1122" "ibm-1122" [4] "ibm-1122_P100-1999" "x-IBM1122" $`ibm-1123_P100-1995` [1] "1123" "cp1123" "ibm-1123" [4] "ibm-1123_P100-1995" "x-IBM1123" $`ibm-1124_P100-1996` [1] "1124" "cp1124" "ibm-1124" [4] "ibm-1124_P100-1996" "x-IBM1124" $`ibm-1125_P100-1997` [1] "cp1125" "ibm-1125" "ibm-1125_P100-1997" $`ibm-1129_P100-1997` [1] "ibm-1129" "ibm-1129_P100-1997" $`ibm-1130_P100-1997` [1] "ibm-1130" "ibm-1130_P100-1997" $`ibm-1131_P100-1997` [1] "cp1131" "ibm-1131" "ibm-1131_P100-1997" $`ibm-1132_P100-1998` [1] "ibm-1132" "ibm-1132_P100-1998" $`ibm-1133_P100-1997` [1] "ibm-1133" "ibm-1133_P100-1997" $`ibm-1137_P100-1999` [1] "ibm-1137" "ibm-1137_P100-1999" $`ibm-1140_P100-1997` [1] "CCSID01140" "CP01140" "cp1140" [4] "ebcdic-us-37+euro" "ibm-1140" "ibm-1140_P100-1997" [7] "IBM01140" $`ibm-1140_P100-1997,swaplfnl` [1] "ibm-1140_P100-1997,swaplfnl" "ibm-1140-s390" $`ibm-1141_P100-1997` [1] "CCSID01141" "CP01141" "cp1141" [4] "ebcdic-de-273+euro" "ibm-1141" "ibm-1141_P100-1997" [7] "IBM01141" $`ibm-1141_P100-1997,swaplfnl` [1] "ibm-1141_P100-1997,swaplfnl" "ibm-1141-s390" [3] "IBM1141_LF" $`ibm-1142_P100-1997` [1] "CCSID01142" "CP01142" "cp1142" [4] "ebcdic-dk-277+euro" "ebcdic-no-277+euro" "ibm-1142" [7] "ibm-1142_P100-1997" "IBM01142" $`ibm-1142_P100-1997,swaplfnl` [1] "ibm-1142_P100-1997,swaplfnl" "ibm-1142-s390" $`ibm-1143_P100-1997` [1] "CCSID01143" "CP01143" "cp1143" [4] "ebcdic-fi-278+euro" "ebcdic-se-278+euro" "ibm-1143" [7] "ibm-1143_P100-1997" "IBM01143" $`ibm-1143_P100-1997,swaplfnl` [1] "ibm-1143_P100-1997,swaplfnl" "ibm-1143-s390" $`ibm-1144_P100-1997` [1] "CCSID01144" "CP01144" "cp1144" [4] "ebcdic-it-280+euro" "ibm-1144" "ibm-1144_P100-1997" [7] "IBM01144" $`ibm-1144_P100-1997,swaplfnl` [1] "ibm-1144_P100-1997,swaplfnl" "ibm-1144-s390" $`ibm-1145_P100-1997` [1] "CCSID01145" "CP01145" "cp1145" [4] "ebcdic-es-284+euro" "ibm-1145" "ibm-1145_P100-1997" [7] "IBM01145" $`ibm-1145_P100-1997,swaplfnl` [1] "ibm-1145_P100-1997,swaplfnl" "ibm-1145-s390" $`ibm-1146_P100-1997` [1] "CCSID01146" "CP01146" "cp1146" [4] "ebcdic-gb-285+euro" "ibm-1146" "ibm-1146_P100-1997" [7] "IBM01146" $`ibm-1146_P100-1997,swaplfnl` [1] "ibm-1146_P100-1997,swaplfnl" "ibm-1146-s390" $`ibm-1147_P100-1997` [1] "CCSID01147" "CP01147" "cp1147" [4] "ebcdic-fr-297+euro" "ibm-1147" "ibm-1147_P100-1997" [7] "IBM01147" $`ibm-1147_P100-1997,swaplfnl` [1] "ibm-1147_P100-1997,swaplfnl" "ibm-1147-s390" $`ibm-1148_P100-1997` [1] "CCSID01148" "CP01148" [3] "cp1148" "ebcdic-international-500+euro" [5] "ibm-1148" "ibm-1148_P100-1997" [7] "IBM01148" $`ibm-1148_P100-1997,swaplfnl` [1] "ibm-1148_P100-1997,swaplfnl" "ibm-1148-s390" $`ibm-1149_P100-1997` [1] "CCSID01149" "CP01149" "cp1149" [4] "ebcdic-is-871+euro" "ibm-1149" "ibm-1149_P100-1997" [7] "IBM01149" $`ibm-1149_P100-1997,swaplfnl` [1] "ibm-1149_P100-1997,swaplfnl" "ibm-1149-s390" $`ibm-1153_P100-1999` [1] "ibm-1153" "ibm-1153_P100-1999" "IBM1153" [4] "x-IBM1153" $`ibm-1153_P100-1999,swaplfnl` [1] "ibm-1153_P100-1999,swaplfnl" "ibm-1153-s390" $`ibm-1154_P100-1999` [1] "ibm-1154" "ibm-1154_P100-1999" $`ibm-1155_P100-1999` [1] "ibm-1155" "ibm-1155_P100-1999" $`ibm-1156_P100-1999` [1] "ibm-1156" "ibm-1156_P100-1999" $`ibm-1157_P100-1999` [1] "ibm-1157" "ibm-1157_P100-1999" $`ibm-1158_P100-1999` [1] "ibm-1158" "ibm-1158_P100-1999" $`ibm-1160_P100-1999` [1] "ibm-1160" "ibm-1160_P100-1999" $`ibm-1162_P100-1999` [1] "ibm-1162" "ibm-1162_P100-1999" $`ibm-1164_P100-1999` [1] "ibm-1164" "ibm-1164_P100-1999" $`ibm-1168_P100-2002` [1] "ibm-1168" "ibm-1168_P100-2002" "KOI8-U" [4] "windows-21866" $`ibm-1250_P100-1995` [1] "ibm-1250" "ibm-1250_P100-1995" "windows-1250" $`ibm-1251_P100-1995` [1] "ibm-1251" "ibm-1251_P100-1995" "windows-1251" $`ibm-1252_P100-2000` [1] "ibm-1252" "ibm-1252_P100-2000" "windows-1252" $`ibm-1253_P100-1995` [1] "ibm-1253" "ibm-1253_P100-1995" "windows-1253" $`ibm-1254_P100-1995` [1] "ibm-1254" "ibm-1254_P100-1995" "windows-1254" $`ibm-1255_P100-1995` [1] "ibm-1255" "ibm-1255_P100-1995" $`ibm-1256_P110-1997` [1] "ibm-1256" "ibm-1256_P110-1997" $`ibm-1257_P100-1995` [1] "ibm-1257" "ibm-1257_P100-1995" $`ibm-1258_P100-1997` [1] "ibm-1258" "ibm-1258_P100-1997" "windows-1258" $`ibm-1276_P100-1995` [1] "Adobe-Standard-Encoding" "csAdobeStandardEncoding" [3] "ibm-1276" "ibm-1276_P100-1995" $`ibm-1363_P11B-1998` [1] "5601" "cp1363" "csKSC56011987" [4] "ibm-1363" "ibm-1363_P11B-1998" "ibm-1363_VSUB_VPUA" [7] "iso-ir-149" "korean" "KS_C_5601-1987" [10] "KS_C_5601-1989" "ksc" "KSC_5601" [13] "windows-949" "x-IBM1363C" $`ibm-1363_P110-1997` [1] "ibm-1363" "ibm-1363_P110-1997" [3] "ibm-1363_VASCII_VSUB_VPUA" "x-IBM1363" $`ibm-1364_P110-2007` [1] "ibm-1364" "ibm-1364_P110-2007" "x-IBM1364" $`ibm-1371_P100-1999` [1] "ibm-1371" "ibm-1371_P100-1999" "x-IBM1371" $`ibm-1373_P100-2002` [1] "ibm-1373" "ibm-1373_P100-2002" "windows-950" $`ibm-1375_P100-2008` [1] "Big5-HKSCS" "big5hk" "HKSCS-BIG5" [4] "ibm-1375" "ibm-1375_P100-2008" $`ibm-1383_P110-1999` [1] "1383" "cp1383" "csGB2312" [4] "EUC-CN" "GB2312" "hp15CN" [7] "ibm-1383" "ibm-1383_P110-1999" "ibm-1383_VPUA" [10] "ibm-eucCN" $`ibm-1386_P100-2001` [1] "cp1386" "ibm-1386" "ibm-1386_P100-2001" [4] "ibm-1386_VSUB_VPUA" "windows-936" $`ibm-1388_P103-2001` [1] "ibm-1388" "ibm-1388_P103-2001" "ibm-9580" [4] "x-IBM1388" $`ibm-1390_P110-2003` [1] "ibm-1390" "ibm-1390_P110-2003" "x-IBM1390" $`ibm-1399_P110-2003` [1] "ibm-1399" "ibm-1399_P110-2003" "x-IBM1399" $`ibm-4517_P100-2005` [1] "ibm-4517" "ibm-4517_P100-2005" $`ibm-4899_P100-1998` [1] "ibm-4899" "ibm-4899_P100-1998" $`ibm-4909_P100-1999` [1] "ibm-4909" "ibm-4909_P100-1999" $`ibm-4971_P100-1999` [1] "ibm-4971" "ibm-4971_P100-1999" $`ibm-5012_P100-1999` [1] "8859_8" "csISOLatinHebrew" "hebrew" [4] "hebrew8" "ibm-5012" "ibm-5012_P100-1999" [7] "ISO_8859-8:1988" "ISO-8859-8" "ISO-8859-8-E" [10] "ISO-8859-8-I" "iso-ir-138" "windows-28598" $`ibm-5123_P100-1999` [1] "ibm-5123" "ibm-5123_P100-1999" $`ibm-5346_P100-1998` [1] "cp1250" "ibm-5346" "ibm-5346_P100-1998" [4] "windows-1250" $`ibm-5347_P100-1998` [1] "ANSI1251" "cp1251" "ibm-5347" [4] "ibm-5347_P100-1998" "windows-1251" $`ibm-5348_P100-1997` [1] "cp1252" "ibm-5348" "ibm-5348_P100-1997" [4] "windows-1252" $`ibm-5349_P100-1998` [1] "cp1253" "ibm-5349" "ibm-5349_P100-1998" [4] "windows-1253" $`ibm-5350_P100-1998` [1] "cp1254" "ibm-5350" "ibm-5350_P100-1998" [4] "windows-1254" $`ibm-5351_P100-1998` [1] "ibm-5351" "ibm-5351_P100-1998" "windows-1255" $`ibm-5352_P100-1998` [1] "ibm-5352" "ibm-5352_P100-1998" "windows-1256" $`ibm-5353_P100-1998` [1] "ibm-5353" "ibm-5353_P100-1998" "windows-1257" $`ibm-5354_P100-1998` [1] "cp1258" "ibm-5354" "ibm-5354_P100-1998" [4] "windows-1258" $`ibm-5471_P100-2006` [1] "Big5-HKSCS" "big5-hkscs:unicode3.0" "hkbig5" [4] "ibm-5471" "ibm-5471_P100-2006" "MS950_HKSCS" [7] "x-MS950-HKSCS" $`ibm-5478_P100-1995` [1] "chinese" "csISO58GB231280" "GB_2312-80" [4] "gb2312-1980" "GB2312.1980-0" "ibm-5478" [7] "ibm-5478_P100-1995" "iso-ir-58" $`ibm-8482_P100-1999` [1] "ibm-8482" "ibm-8482_P100-1999" $`ibm-9005_X110-2007` [1] "8859_7" "csISOLatinGreek" "ECMA-118" [4] "ELOT_928" "greek" "greek8" [7] "ibm-9005" "ibm-9005_X110-2007" "ISO_8859-7:1987" [10] "ISO-8859-7" "iso-ir-126" "sun_eu_greek" [13] "windows-28597" $`ibm-9067_X100-2005` [1] "ibm-9067" "ibm-9067_X100-2005" $`ibm-9447_P100-2002` [1] "cp1255" "ibm-9447" "ibm-9447_P100-2002" [4] "windows-1255" $`ibm-9448_X100-2005` [1] "cp1256" "ibm-9448" "ibm-9448_X100-2005" [4] "windows-1256" "x-windows-1256S" $`ibm-9449_P100-2002` [1] "cp1257" "ibm-9449" "ibm-9449_P100-2002" [4] "windows-1257" $`ibm-12712_P100-1998` [1] "ebcdic-he" "ibm-12712" "ibm-12712_P100-1998" $`ibm-12712_P100-1998,swaplfnl` [1] "ibm-12712_P100-1998,swaplfnl" "ibm-12712-s390" $`ibm-16684_P110-2003` [1] "ibm-16684" "ibm-16684_P110-2003" "ibm-20780" $`ibm-16804_X110-1999` [1] "ebcdic-ar" "ibm-16804" "ibm-16804_X110-1999" $`ibm-16804_X110-1999,swaplfnl` [1] "ibm-16804_X110-1999,swaplfnl" "ibm-16804-s390" $`ibm-33722_P12A_P12A-2009_U2` [1] "ibm-5050" "ibm-33722" [3] "ibm-33722_P12A_P12A-2009_U2" "ibm-33722_VPUA" [5] "IBM-eucJP" $`ibm-33722_P120-1999` [1] "33722" "cp33722" "ibm-5050" [4] "ibm-33722" "ibm-33722_P120-1999" "ibm-33722_VASCII_VPUA" [7] "x-IBM33722" "x-IBM33722A" "x-IBM33722C" $`IMAP-mailbox-name` [1] "IMAP-mailbox-name" $`ISCII,version=0` [1] "ibm-4902" "iscii-dev" "ISCII,version=0" "windows-57002" [5] "x-iscii-de" "x-ISCII91" $`ISCII,version=1` [1] "iscii-bng" "ISCII,version=1" "windows-57003" "windows-57006" [5] "x-iscii-as" "x-iscii-be" $`ISCII,version=2` [1] "iscii-gur" "ISCII,version=2" "windows-57011" "x-iscii-pa" $`ISCII,version=3` [1] "iscii-guj" "ISCII,version=3" "windows-57010" "x-iscii-gu" $`ISCII,version=4` [1] "iscii-ori" "ISCII,version=4" "windows-57007" "x-iscii-or" $`ISCII,version=5` [1] "iscii-tml" "ISCII,version=5" "windows-57004" "x-iscii-ta" $`ISCII,version=6` [1] "iscii-tlg" "ISCII,version=6" "windows-57005" "x-iscii-te" $`ISCII,version=7` [1] "iscii-knd" "ISCII,version=7" "windows-57008" "x-iscii-ka" $`ISCII,version=8` [1] "iscii-mlm" "ISCII,version=8" "windows-57009" "x-iscii-ma" $`ISO_2022,locale=ja,version=0` [1] "csISO2022JP" "ISO_2022,locale=ja,version=0" [3] "ISO-2022-JP" "x-windows-50220" [5] "x-windows-iso2022jp" $`ISO_2022,locale=ja,version=1` [1] "csJISEncoding" "ibm-5054" [3] "ISO_2022,locale=ja,version=1" "ISO-2022-JP-1" [5] "JIS" "JIS_Encoding" [7] "x-windows-50221" $`ISO_2022,locale=ja,version=2` [1] "csISO2022JP2" "ISO_2022,locale=ja,version=2" [3] "ISO-2022-JP-2" $`ISO_2022,locale=ja,version=3` [1] "ISO_2022,locale=ja,version=3" "JIS7" $`ISO_2022,locale=ja,version=4` [1] "ISO_2022,locale=ja,version=4" "JIS8" $`ISO_2022,locale=ko,version=0` [1] "csISO2022KR" "ISO_2022,locale=ko,version=0" [3] "ISO-2022-KR" $`ISO_2022,locale=ko,version=1` [1] "ibm-25546" "ISO_2022,locale=ko,version=1" $`ISO_2022,locale=zh,version=0` [1] "csISO2022CN" "ISO_2022,locale=zh,version=0" [3] "ISO-2022-CN" "x-ISO-2022-CN-GB" $`ISO_2022,locale=zh,version=1` [1] "ISO_2022,locale=zh,version=1" "ISO-2022-CN-EXT" $`ISO_2022,locale=zh,version=2` [1] "ISO_2022,locale=zh,version=2" "ISO-2022-CN-CNS" [3] "x-ISO-2022-CN-CNS" $`iso-8859_10-1998` [1] "csISOLatin6" "ISO_8859-10:1992" "iso-8859_10-1998" "ISO-8859-10" [5] "iso-ir-157" "l6" "latin6" $`iso-8859_11-2001` [1] "iso-8859_11-2001" "ISO-8859-11" "thai8" "x-iso-8859-11" $`iso-8859_14-1998` [1] "ISO_8859-14:1998" "iso-8859_14-1998" "ISO-8859-14" "iso-celtic" [5] "iso-ir-199" "l8" "latin8" $`ISO-8859-1` [1] "819" "8859_1" "cp819" "csISOLatin1" [5] "ibm-819" "IBM819" "ISO_8859-1:1987" "ISO-8859-1" [9] "iso-ir-100" "l1" "latin1" $`LMBCS-1` [1] "ibm-65025" "lmbcs" "LMBCS-1" $`macos-0_2-10.2` [1] "csMacintosh" "mac" "macintosh" "macos-0_2-10.2" [5] "macroman" "windows-10000" "x-macroman" $`macos-6_2-10.4` [1] "macgr" "macos-6_2-10.4" "windows-10006" "x-mac-greek" [5] "x-MacGreek" $`macos-7_3-10.2` [1] "mac-cyrillic" "maccy" "macos-7_3-10.2" "windows-10007" [5] "x-mac-cyrillic" "x-MacCyrillic" "x-MacUkraine" $`macos-29-10.2` [1] "macce" "maccentraleurope" "macos-29-10.2" [4] "windows-10029" "x-mac-ce" "x-mac-centraleurroman" [7] "x-MacCentralEurope" $`macos-35-10.2` [1] "macos-35-10.2" "mactr" "windows-10081" "x-mac-turkish" [5] "x-MacTurkish" $SCSU [1] "ibm-1212" "ibm-1213" "SCSU" $`US-ASCII` [1] "646" "ANSI_X3.4-1968" "ANSI_X3.4-1986" "ASCII" [5] "ascii7" "cp367" "csASCII" "ibm-367" [9] "IBM367" "iso_646.irv:1983" "ISO_646.irv:1991" "iso-ir-6" [13] "ISO646-US" "us" "US-ASCII" "windows-20127" $`UTF-7` [1] "unicode-1-1-utf-7" "unicode-2-0-utf-7" "UTF-7" [4] "windows-65000" $`UTF-8` [1] "cp1208" "ibm-1208" "ibm-1209" [4] "ibm-5304" "ibm-5305" "ibm-13496" [7] "ibm-13497" "ibm-17592" "ibm-17593" [10] "unicode-1-1-utf-8" "unicode-2-0-utf-8" "UTF-8" [13] "windows-65001" "x-UTF_8J" $`UTF-16` [1] "csUnicode" "ibm-1204" "ibm-1205" "ISO-10646-UCS-2" [5] "ucs-2" "unicode" "UTF-16" $`UTF-16,version=1` [1] "UTF-16,version=1" $`UTF-16,version=2` [1] "UTF-16,version=2" $`UTF-16BE` [1] "cp1200" "cp1201" "ibm-1200" [4] "ibm-1201" "ibm-13488" "ibm-13489" [7] "ibm-17584" "ibm-17585" "ibm-21680" [10] "ibm-21681" "ibm-25776" "ibm-25777" [13] "ibm-29872" "ibm-29873" "ibm-61955" [16] "ibm-61956" "UnicodeBigUnmarked" "UTF-16BE" [19] "UTF16_BigEndian" "windows-1201" "x-utf-16be" $`UTF-16BE,version=1` [1] "UnicodeBig" "UTF-16BE,version=1" $`UTF-16LE` [1] "ibm-1202" "ibm-1203" "ibm-13490" [4] "ibm-13491" "ibm-17586" "ibm-17587" [7] "ibm-21682" "ibm-21683" "ibm-25778" [10] "ibm-25779" "ibm-29874" "ibm-29875" [13] "UnicodeLittleUnmarked" "UTF-16LE" "UTF16_LittleEndian" [16] "windows-1200" "x-utf-16le" $`UTF-16LE,version=1` [1] "UnicodeLittle" "UTF-16LE,version=1" "x-UTF-16LE-BOM" $`UTF-32` [1] "csUCS4" "ibm-1236" "ibm-1237" "ISO-10646-UCS-4" [5] "ucs-4" "UTF-32" $`UTF-32BE` [1] "ibm-1232" "ibm-1233" "ibm-9424" "UTF-32BE" [5] "UTF32_BigEndian" $`UTF-32LE` [1] "ibm-1234" "ibm-1235" "UTF-32LE" [4] "UTF32_LittleEndian" $UTF16_OppositeEndian [1] "UTF16_OppositeEndian" $UTF16_PlatformEndian [1] "UTF16_PlatformEndian" $UTF32_OppositeEndian [1] "UTF32_OppositeEndian" $UTF32_PlatformEndian [1] "UTF32_PlatformEndian" $`windows-874-2000` [1] "MS874" "TIS-620" "windows-874" "windows-874-2000" [5] "x-windows-874" $`windows-936-2000` [1] "CP936" "GBK" "MS936" "windows-936" [5] "windows-936-2000" $`windows-949-2000` [1] "csKSC56011987" "iso-ir-149" "korean" "KS_C_5601-1987" [5] "KS_C_5601-1989" "KSC_5601" "ms949" "windows-949" [9] "windows-949-2000" "x-KSC5601" $`windows-950-2000` [1] "Big5" "csBig5" "ms950" "windows-950" [5] "windows-950-2000" "x-big5" "x-windows-950" $`x11-compound-text` [1] "COMPOUND_TEXT" "x-compound-text" "x11-compound-text" > > > > > cleanEx() > nameEx("stri_escape_unicode") > ### * stri_escape_unicode > > flush(stderr()); flush(stdout()) > > ### Name: stri_escape_unicode > ### Title: Escape Unicode Code Points > ### Aliases: stri_escape_unicode > > ### ** Examples > > stri_escape_unicode('a\u0105!') [1] "a\\u0105!" > > > > > cleanEx() > nameEx("stri_extract") > ### * stri_extract > > flush(stderr()); flush(stdout()) > > ### Name: stri_extract_all > ### Title: Extract Pattern Occurrences > ### Aliases: stri_extract_all stri_extract_first stri_extract_last > ### stri_extract stri_extract_all_charclass stri_extract_first_charclass > ### stri_extract_last_charclass stri_extract_all_coll > ### stri_extract_first_coll stri_extract_last_coll stri_extract_all_regex > ### stri_extract_first_regex stri_extract_last_regex > ### stri_extract_all_fixed stri_extract_first_fixed > ### stri_extract_last_fixed > > ### ** Examples > > stri_extract_all('XaaaaX', regex=c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?')) [[1]] [1] "a" "a" "a" "a" [[2]] [1] "aaaa" [[3]] [1] "aaa" [[4]] [1] "aa" "aa" > stri_extract_all('Bartolini', coll='i') [[1]] [1] "i" "i" > stri_extract_all('stringi is so good!', charclass='\\p{Zs}') # all white-spaces [[1]] [1] " " " " " " > > stri_extract_all_charclass(c('AbcdeFgHijK', 'abc', 'ABC'), '\\p{Ll}') [[1]] [1] "bcde" "g" "ij" [[2]] [1] "abc" [[3]] [1] NA > stri_extract_all_charclass(c('AbcdeFgHijK', 'abc', 'ABC'), '\\p{Ll}', merge=FALSE) [[1]] [1] "b" "c" "d" "e" "g" "i" "j" [[2]] [1] "a" "b" "c" [[3]] [1] NA > stri_extract_first_charclass('AaBbCc', '\\p{Ll}') [1] "a" > stri_extract_last_charclass('AaBbCc', '\\p{Ll}') [1] "c" > > ## Not run: > ##D # emoji support available since ICU 57 > ##D stri_extract_all_charclass(stri_enc_fromutf32(32:55200), '\\p{EMOJI}') > ## End(Not run) > > stri_extract_all_coll(c('AaaaaaaA', 'AAAA'), 'a') [[1]] [1] "a" "a" "a" "a" "a" "a" [[2]] [1] NA > stri_extract_first_coll(c('Yy\u00FD', 'AAA'), 'y', strength=2, locale='sk_SK') [1] "Y" NA > stri_extract_last_coll(c('Yy\u00FD', 'AAA'), 'y', strength=1, locale='sk_SK') [1] "ý" NA > > stri_extract_all_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?')) [[1]] [1] "a" "a" "a" "a" [[2]] [1] "aaaa" [[3]] [1] "aaa" [[4]] [1] "aa" "aa" > stri_extract_first_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?')) [1] "a" "aaaa" "aaa" "aa" > stri_extract_last_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?')) [1] "a" "aaaa" "aaa" "aa" > > stri_list2matrix(stri_extract_all_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+'))) [,1] [,2] [1,] "a" "aaaa" [2,] "a" NA [3,] "a" NA [4,] "a" NA > stri_extract_all_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+'), simplify=TRUE) [,1] [,2] [,3] [,4] [1,] "a" "a" "a" "a" [2,] "aaaa" "" "" "" > stri_extract_all_regex('XaaaaX', c('\\p{Ll}', '\\p{Ll}+'), simplify=NA) [,1] [,2] [,3] [,4] [1,] "a" "a" "a" "a" [2,] "aaaa" NA NA NA > > stri_extract_all_fixed('abaBAba', 'Aba', case_insensitive=TRUE) [[1]] [1] "aba" "Aba" > stri_extract_all_fixed('abaBAba', 'Aba', case_insensitive=TRUE, overlap=TRUE) [[1]] [1] "aba" "aBA" "Aba" > > # Searching for the last occurrence: > # Note the difference - regex searches left to right, with no overlaps. > stri_extract_last_fixed("agAGA", "aga", case_insensitive=TRUE) [1] "AGA" > stri_extract_last_regex("agAGA", "aga", case_insensitive=TRUE) [1] "agA" > > > > > cleanEx() > nameEx("stri_extract_boundaries") > ### * stri_extract_boundaries > > flush(stderr()); flush(stdout()) > > ### Name: stri_extract_all_boundaries > ### Title: Extract Data Between Text Boundaries > ### Aliases: stri_extract_all_boundaries stri_extract_last_boundaries > ### stri_extract_first_boundaries stri_extract_all_words > ### stri_extract_first_words stri_extract_last_words > > ### ** Examples > > stri_extract_all_words('stringi: THE string processing package 123.48...') [[1]] [1] "stringi" "THE" "string" "processing" "package" [6] "123.48" > > > > > cleanEx() > nameEx("stri_flatten") > ### * stri_flatten > > flush(stderr()); flush(stdout()) > > ### Name: stri_flatten > ### Title: Flatten a String > ### Aliases: stri_flatten > > ### ** Examples > > stri_flatten(LETTERS) [1] "ABCDEFGHIJKLMNOPQRSTUVWXYZ" > stri_flatten(LETTERS, collapse=',') [1] "A,B,C,D,E,F,G,H,I,J,K,L,M,N,O,P,Q,R,S,T,U,V,W,X,Y,Z" > stri_flatten(stri_dup(letters[1:6], 1:3)) [1] "abbcccdeefff" > stri_flatten(c(NA, '', 'A', '', 'B', NA, 'C'), collapse=',', na_empty=TRUE, omit_empty=TRUE) [1] "A,B,C" > stri_flatten(c(NA, '', 'A', '', 'B', NA, 'C'), collapse=',', na_empty=NA) [1] ",A,,B,C" > > > > > cleanEx() > nameEx("stri_isempty") > ### * stri_isempty > > flush(stderr()); flush(stdout()) > > ### Name: stri_isempty > ### Title: Determine if a String is of Length Zero > ### Aliases: stri_isempty > > ### ** Examples > > stri_isempty(letters[1:3]) [1] FALSE FALSE FALSE > stri_isempty(c(',', '', 'abc', '123', '\u0105\u0104')) [1] FALSE TRUE FALSE FALSE FALSE > stri_isempty(character(1)) [1] TRUE > > > > > cleanEx() > nameEx("stri_join") > ### * stri_join > > flush(stderr()); flush(stdout()) > > ### Name: stri_join > ### Title: Concatenate Character Vectors > ### Aliases: stri_join stri_c stri_paste > > ### ** Examples > > stri_join(1:13, letters) [1] "1a" "2b" "3c" "4d" "5e" "6f" "7g" "8h" "9i" "10j" "11k" "12l" [13] "13m" "1n" "2o" "3p" "4q" "5r" "6s" "7t" "8u" "9v" "10w" "11x" [25] "12y" "13z" > stri_join(1:13, letters, sep=',') [1] "1,a" "2,b" "3,c" "4,d" "5,e" "6,f" "7,g" "8,h" "9,i" "10,j" [11] "11,k" "12,l" "13,m" "1,n" "2,o" "3,p" "4,q" "5,r" "6,s" "7,t" [21] "8,u" "9,v" "10,w" "11,x" "12,y" "13,z" > stri_join(1:13, letters, collapse='; ') [1] "1a; 2b; 3c; 4d; 5e; 6f; 7g; 8h; 9i; 10j; 11k; 12l; 13m; 1n; 2o; 3p; 4q; 5r; 6s; 7t; 8u; 9v; 10w; 11x; 12y; 13z" > stri_join(1:13, letters, sep=',', collapse='; ') [1] "1,a; 2,b; 3,c; 4,d; 5,e; 6,f; 7,g; 8,h; 9,i; 10,j; 11,k; 12,l; 13,m; 1,n; 2,o; 3,p; 4,q; 5,r; 6,s; 7,t; 8,u; 9,v; 10,w; 11,x; 12,y; 13,z" > stri_join(c('abc', '123', 'xyz'),'###', 1:6, sep=',') [1] "abc,###,1" "123,###,2" "xyz,###,3" "abc,###,4" "123,###,5" "xyz,###,6" > stri_join(c('abc', '123', 'xyz'),'###', 1:6, sep=',', collapse='; ') [1] "abc,###,1; 123,###,2; xyz,###,3; abc,###,4; 123,###,5; xyz,###,6" > > > > > cleanEx() > nameEx("stri_join_list") > ### * stri_join_list > > flush(stderr()); flush(stdout()) > > ### Name: stri_join_list > ### Title: Concatenate Strings in a List > ### Aliases: stri_join_list stri_c_list stri_paste_list > > ### ** Examples > > stri_join_list( + stri_extract_all_words(c('Lorem ipsum dolor sit amet.', + 'Spam spam bacon sausage and spam.')), + sep=', ') [1] "Lorem, ipsum, dolor, sit, amet" [2] "Spam, spam, bacon, sausage, and, spam" > > stri_join_list( + stri_extract_all_words(c('Lorem ipsum dolor sit amet.', + 'Spam spam bacon sausage and spam.')), + sep=', ', collapse='. ') [1] "Lorem, ipsum, dolor, sit, amet. Spam, spam, bacon, sausage, and, spam" > > stri_join_list( + stri_extract_all_regex( + c('spam spam bacon', '123 456', 'spam 789 sausage'), '\\p{L}+' + ), + sep=',') [1] "spam,spam,bacon" NA "spam,sausage" > > stri_join_list( + stri_extract_all_regex( + c('spam spam bacon', '123 456', 'spam 789 sausage'), '\\p{L}+', + omit_no_match=TRUE + ), + sep=',', collapse='; ') [1] "spam,spam,bacon; spam,sausage" > > > > > cleanEx() > nameEx("stri_length") > ### * stri_length > > flush(stderr()); flush(stdout()) > > ### Name: stri_length > ### Title: Count the Number of Code Points > ### Aliases: stri_length > > ### ** Examples > > stri_length(LETTERS) [1] 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 > stri_length(c('abc', '123', '\u0105\u0104')) [1] 3 3 2 > stri_length('\u0105') # length is one, but... [1] 1 > stri_numbytes('\u0105') # 2 bytes are used [1] 2 > stri_numbytes(stri_trans_nfkd('\u0105')) # 3 bytes here but... [1] 3 > stri_length(stri_trans_nfkd('\u0105')) # ...two code points (!) [1] 2 > stri_count_boundaries(stri_trans_nfkd('\u0105'), type='character') # ...and one Unicode character [1] 1 > > > > > cleanEx() > nameEx("stri_list2matrix") > ### * stri_list2matrix > > flush(stderr()); flush(stdout()) > > ### Name: stri_list2matrix > ### Title: Convert a List to a Character Matrix > ### Aliases: stri_list2matrix > > ### ** Examples > > simplify2array(list(c('a', 'b'), c('c', 'd'), c('e', 'f'))) [,1] [,2] [,3] [1,] "a" "c" "e" [2,] "b" "d" "f" > stri_list2matrix(list(c('a', 'b'), c('c', 'd'), c('e', 'f'))) [,1] [,2] [,3] [1,] "a" "c" "e" [2,] "b" "d" "f" > stri_list2matrix(list(c('a', 'b'), c('c', 'd'), c('e', 'f')), byrow=TRUE) [,1] [,2] [1,] "a" "b" [2,] "c" "d" [3,] "e" "f" > > simplify2array(list('a', c('b', 'c'))) [[1]] [1] "a" [[2]] [1] "b" "c" > stri_list2matrix(list('a', c('b', 'c'))) [,1] [,2] [1,] "a" "b" [2,] NA "c" > stri_list2matrix(list('a', c('b', 'c')), fill='') [,1] [,2] [1,] "a" "b" [2,] "" "c" > stri_list2matrix(list('a', c('b', 'c')), fill='', n_min=5) [,1] [,2] [1,] "a" "b" [2,] "" "c" [3,] "" "" [4,] "" "" [5,] "" "" > > > > > cleanEx() > nameEx("stri_locale_info") > ### * stri_locale_info > > flush(stderr()); flush(stdout()) > > ### Name: stri_locale_info > ### Title: Query Given Locale > ### Aliases: stri_locale_info > > ### ** Examples > > stri_locale_info('pl_PL') $Language [1] "pl" $Country [1] "PL" $Variant [1] "" $Name [1] "pl_PL" > stri_locale_info('Pl_pL') # the same result $Language [1] "pl" $Country [1] "PL" $Variant [1] "" $Name [1] "pl_PL" > > > > > cleanEx() > nameEx("stri_locale_list") > ### * stri_locale_list > > flush(stderr()); flush(stdout()) > > ### Name: stri_locale_list > ### Title: List Available Locales > ### Aliases: stri_locale_list > > ### ** Examples > > stri_locale_list() [1] "af" "af_NA" "af_ZA" "agq" "agq_CM" [6] "ak" "ak_GH" "am" "am_ET" "ar" [11] "ar_001" "ar_AE" "ar_BH" "ar_DJ" "ar_DZ" [16] "ar_EG" "ar_EH" "ar_ER" "ar_IL" "ar_IQ" [21] "ar_JO" "ar_KM" "ar_KW" "ar_LB" "ar_LY" [26] "ar_MA" "ar_MR" "ar_OM" "ar_PS" "ar_QA" [31] "ar_SA" "ar_SD" "ar_SO" "ar_SS" "ar_SY" [36] "ar_TD" "ar_TN" "ar_YE" "as" "as_IN" [41] "asa" "asa_TZ" "ast" "ast_ES" "az" [46] "az_Cyrl" "az_Cyrl_AZ" "az_Latn" "az_Latn_AZ" "bas" [51] "bas_CM" "be" "be_BY" "bem" "bem_ZM" [56] "bez" "bez_TZ" "bg" "bg_BG" "bgc" [61] "bgc_IN" "bho" "bho_IN" "blo" "blo_BJ" [66] "bm" "bm_ML" "bn" "bn_BD" "bn_IN" [71] "bo" "bo_CN" "bo_IN" "br" "br_FR" [76] "brx" "brx_IN" "bs" "bs_Cyrl" "bs_Cyrl_BA" [81] "bs_Latn" "bs_Latn_BA" "ca" "ca_AD" "ca_ES" [86] "ca_FR" "ca_IT" "ccp" "ccp_BD" "ccp_IN" [91] "ce" "ce_RU" "ceb" "ceb_PH" "cgg" [96] "cgg_UG" "chr" "chr_US" "ckb" "ckb_IQ" [101] "ckb_IR" "cs" "cs_CZ" "csw" "csw_CA" [106] "cv" "cv_RU" "cy" "cy_GB" "da" [111] "da_DK" "da_GL" "dav" "dav_KE" "de" [116] "de_AT" "de_BE" "de_CH" "de_DE" "de_IT" [121] "de_LI" "de_LU" "dje" "dje_NE" "doi" [126] "doi_IN" "dsb" "dsb_DE" "dua" "dua_CM" [131] "dyo" "dyo_SN" "dz" "dz_BT" "ebu" [136] "ebu_KE" "ee" "ee_GH" "ee_TG" "el" [141] "el_CY" "el_GR" "en" "en_001" "en_150" [146] "en_AE" "en_AG" "en_AI" "en_AS" "en_AT" [151] "en_AU" "en_BB" "en_BE" "en_BI" "en_BM" [156] "en_BS" "en_BW" "en_BZ" "en_CA" "en_CC" [161] "en_CH" "en_CK" "en_CM" "en_CX" "en_CY" [166] "en_DE" "en_DG" "en_DK" "en_DM" "en_ER" [171] "en_FI" "en_FJ" "en_FK" "en_FM" "en_GB" [176] "en_GD" "en_GG" "en_GH" "en_GI" "en_GM" [181] "en_GU" "en_GY" "en_HK" "en_ID" "en_IE" [186] "en_IL" "en_IM" "en_IN" "en_IO" "en_JE" [191] "en_JM" "en_KE" "en_KI" "en_KN" "en_KY" [196] "en_LC" "en_LR" "en_LS" "en_MG" "en_MH" [201] "en_MO" "en_MP" "en_MS" "en_MT" "en_MU" [206] "en_MV" "en_MW" "en_MY" "en_NA" "en_NF" [211] "en_NG" "en_NL" "en_NR" "en_NU" "en_NZ" [216] "en_PG" "en_PH" "en_PK" "en_PN" "en_PR" [221] "en_PW" "en_RW" "en_SB" "en_SC" "en_SD" [226] "en_SE" "en_SG" "en_SH" "en_SI" "en_SL" [231] "en_SS" "en_SX" "en_SZ" "en_TC" "en_TK" [236] "en_TO" "en_TT" "en_TV" "en_TZ" "en_UG" [241] "en_UM" "en_US" "en_US_POSIX" "en_VC" "en_VG" [246] "en_VI" "en_VU" "en_WS" "en_ZA" "en_ZM" [251] "en_ZW" "eo" "eo_001" "es" "es_419" [256] "es_AR" "es_BO" "es_BR" "es_BZ" "es_CL" [261] "es_CO" "es_CR" "es_CU" "es_DO" "es_EA" [266] "es_EC" "es_ES" "es_GQ" "es_GT" "es_HN" [271] "es_IC" "es_MX" "es_NI" "es_PA" "es_PE" [276] "es_PH" "es_PR" "es_PY" "es_SV" "es_US" [281] "es_UY" "es_VE" "et" "et_EE" "eu" [286] "eu_ES" "ewo" "ewo_CM" "fa" "fa_AF" [291] "fa_IR" "ff" "ff_Adlm" "ff_Adlm_BF" "ff_Adlm_CM" [296] "ff_Adlm_GH" "ff_Adlm_GM" "ff_Adlm_GN" "ff_Adlm_GW" "ff_Adlm_LR" [301] "ff_Adlm_MR" "ff_Adlm_NE" "ff_Adlm_NG" "ff_Adlm_SL" "ff_Adlm_SN" [306] "ff_Latn" "ff_Latn_BF" "ff_Latn_CM" "ff_Latn_GH" "ff_Latn_GM" [311] "ff_Latn_GN" "ff_Latn_GW" "ff_Latn_LR" "ff_Latn_MR" "ff_Latn_NE" [316] "ff_Latn_NG" "ff_Latn_SL" "ff_Latn_SN" "fi" "fi_FI" [321] "fil" "fil_PH" "fo" "fo_DK" "fo_FO" [326] "fr" "fr_BE" "fr_BF" "fr_BI" "fr_BJ" [331] "fr_BL" "fr_CA" "fr_CD" "fr_CF" "fr_CG" [336] "fr_CH" "fr_CI" "fr_CM" "fr_DJ" "fr_DZ" [341] "fr_FR" "fr_GA" "fr_GF" "fr_GN" "fr_GP" [346] "fr_GQ" "fr_HT" "fr_KM" "fr_LU" "fr_MA" [351] "fr_MC" "fr_MF" "fr_MG" "fr_ML" "fr_MQ" [356] "fr_MR" "fr_MU" "fr_NC" "fr_NE" "fr_PF" [361] "fr_PM" "fr_RE" "fr_RW" "fr_SC" "fr_SN" [366] "fr_SY" "fr_TD" "fr_TG" "fr_TN" "fr_VU" [371] "fr_WF" "fr_YT" "fur" "fur_IT" "fy" [376] "fy_NL" "ga" "ga_GB" "ga_IE" "gd" [381] "gd_GB" "gl" "gl_ES" "gsw" "gsw_CH" [386] "gsw_FR" "gsw_LI" "gu" "gu_IN" "guz" [391] "guz_KE" "gv" "gv_IM" "ha" "ha_GH" [396] "ha_NE" "ha_NG" "haw" "haw_US" "he" [401] "he_IL" "hi" "hi_IN" "hi_Latn" "hi_Latn_IN" [406] "hr" "hr_BA" "hr_HR" "hsb" "hsb_DE" [411] "hu" "hu_HU" "hy" "hy_AM" "ia" [416] "ia_001" "id" "id_ID" "ie" "ie_EE" [421] "ig" "ig_NG" "ii" "ii_CN" "is" [426] "is_IS" "it" "it_CH" "it_IT" "it_SM" [431] "it_VA" "ja" "ja_JP" "jgo" "jgo_CM" [436] "jmc" "jmc_TZ" "jv" "jv_ID" "ka" [441] "ka_GE" "kab" "kab_DZ" "kam" "kam_KE" [446] "kde" "kde_TZ" "kea" "kea_CV" "kgp" [451] "kgp_BR" "khq" "khq_ML" "ki" "ki_KE" [456] "kk" "kk_KZ" "kkj" "kkj_CM" "kl" [461] "kl_GL" "kln" "kln_KE" "km" "km_KH" [466] "kn" "kn_IN" "ko" "ko_CN" "ko_KP" [471] "ko_KR" "kok" "kok_IN" "ks" "ks_Arab" [476] "ks_Arab_IN" "ks_Deva" "ks_Deva_IN" "ksb" "ksb_TZ" [481] "ksf" "ksf_CM" "ksh" "ksh_DE" "ku" [486] "ku_TR" "kw" "kw_GB" "kxv" "kxv_Deva" [491] "kxv_Deva_IN" "kxv_Latn" "kxv_Latn_IN" "kxv_Orya" "kxv_Orya_IN" [496] "kxv_Telu" "kxv_Telu_IN" "ky" "ky_KG" "lag" [501] "lag_TZ" "lb" "lb_LU" "lg" "lg_UG" [506] "lij" "lij_IT" "lkt" "lkt_US" "lmo" [511] "lmo_IT" "ln" "ln_AO" "ln_CD" "ln_CF" [516] "ln_CG" "lo" "lo_LA" "lrc" "lrc_IQ" [521] "lrc_IR" "lt" "lt_LT" "lu" "lu_CD" [526] "luo" "luo_KE" "luy" "luy_KE" "lv" [531] "lv_LV" "mai" "mai_IN" "mas" "mas_KE" [536] "mas_TZ" "mer" "mer_KE" "mfe" "mfe_MU" [541] "mg" "mg_MG" "mgh" "mgh_MZ" "mgo" [546] "mgo_CM" "mi" "mi_NZ" "mk" "mk_MK" [551] "ml" "ml_IN" "mn" "mn_MN" "mni" [556] "mni_Beng" "mni_Beng_IN" "mr" "mr_IN" "ms" [561] "ms_BN" "ms_ID" "ms_MY" "ms_SG" "mt" [566] "mt_MT" "mua" "mua_CM" "my" "my_MM" [571] "mzn" "mzn_IR" "naq" "naq_NA" "nb" [576] "nb_NO" "nb_SJ" "nd" "nd_ZW" "nds" [581] "nds_DE" "nds_NL" "ne" "ne_IN" "ne_NP" [586] "nl" "nl_AW" "nl_BE" "nl_BQ" "nl_CW" [591] "nl_NL" "nl_SR" "nl_SX" "nmg" "nmg_CM" [596] "nn" "nn_NO" "nnh" "nnh_CM" "no" [601] "nqo" "nqo_GN" "nus" "nus_SS" "nyn" [606] "nyn_UG" "oc" "oc_ES" "oc_FR" "om" [611] "om_ET" "om_KE" "or" "or_IN" "os" [616] "os_GE" "os_RU" "pa" "pa_Arab" "pa_Arab_PK" [621] "pa_Guru" "pa_Guru_IN" "pcm" "pcm_NG" "pl" [626] "pl_PL" "prg" "prg_PL" "ps" "ps_AF" [631] "ps_PK" "pt" "pt_AO" "pt_BR" "pt_CH" [636] "pt_CV" "pt_GQ" "pt_GW" "pt_LU" "pt_MO" [641] "pt_MZ" "pt_PT" "pt_ST" "pt_TL" "qu" [646] "qu_BO" "qu_EC" "qu_PE" "raj" "raj_IN" [651] "rm" "rm_CH" "rn" "rn_BI" "ro" [656] "ro_MD" "ro_RO" "rof" "rof_TZ" "ru" [661] "ru_BY" "ru_KG" "ru_KZ" "ru_MD" "ru_RU" [666] "ru_UA" "rw" "rw_RW" "rwk" "rwk_TZ" [671] "sa" "sa_IN" "sah" "sah_RU" "saq" [676] "saq_KE" "sat" "sat_Olck" "sat_Olck_IN" "sbp" [681] "sbp_TZ" "sc" "sc_IT" "sd" "sd_Arab" [686] "sd_Arab_PK" "sd_Deva" "sd_Deva_IN" "se" "se_FI" [691] "se_NO" "se_SE" "seh" "seh_MZ" "ses" [696] "ses_ML" "sg" "sg_CF" "shi" "shi_Latn" [701] "shi_Latn_MA" "shi_Tfng" "shi_Tfng_MA" "si" "si_LK" [706] "sk" "sk_SK" "sl" "sl_SI" "smn" [711] "smn_FI" "sn" "sn_ZW" "so" "so_DJ" [716] "so_ET" "so_KE" "so_SO" "sq" "sq_AL" [721] "sq_MK" "sq_XK" "sr" "sr_Cyrl" "sr_Cyrl_BA" [726] "sr_Cyrl_ME" "sr_Cyrl_RS" "sr_Cyrl_XK" "sr_Latn" "sr_Latn_BA" [731] "sr_Latn_ME" "sr_Latn_RS" "sr_Latn_XK" "su" "su_Latn" [736] "su_Latn_ID" "sv" "sv_AX" "sv_FI" "sv_SE" [741] "sw" "sw_CD" "sw_KE" "sw_TZ" "sw_UG" [746] "syr" "syr_IQ" "syr_SY" "szl" "szl_PL" [751] "ta" "ta_IN" "ta_LK" "ta_MY" "ta_SG" [756] "te" "te_IN" "teo" "teo_KE" "teo_UG" [761] "tg" "tg_TJ" "th" "th_TH" "ti" [766] "ti_ER" "ti_ET" "tk" "tk_TM" "to" [771] "to_TO" "tok" "tok_001" "tr" "tr_CY" [776] "tr_TR" "tt" "tt_RU" "twq" "twq_NE" [781] "tzm" "tzm_MA" "ug" "ug_CN" "uk" [786] "uk_UA" "ur" "ur_IN" "ur_PK" "uz" [791] "uz_Arab" "uz_Arab_AF" "uz_Cyrl" "uz_Cyrl_UZ" "uz_Latn" [796] "uz_Latn_UZ" "vai" "vai_Latn" "vai_Latn_LR" "vai_Vaii" [801] "vai_Vaii_LR" "vec" "vec_IT" "vi" "vi_VN" [806] "vmw" "vmw_MZ" "vun" "vun_TZ" "wae" [811] "wae_CH" "wo" "wo_SN" "xh" "xh_ZA" [816] "xnr" "xnr_IN" "xog" "xog_UG" "yav" [821] "yav_CM" "yi" "yi_UA" "yo" "yo_BJ" [826] "yo_NG" "yrl" "yrl_BR" "yrl_CO" "yrl_VE" [831] "yue" "yue_Hans" "yue_Hans_CN" "yue_Hant" "yue_Hant_HK" [836] "za" "za_CN" "zgh" "zgh_MA" "zh" [841] "zh_Hans" "zh_Hans_CN" "zh_Hans_HK" "zh_Hans_MO" "zh_Hans_SG" [846] "zh_Hant" "zh_Hant_HK" "zh_Hant_MO" "zh_Hant_TW" "zu" [851] "zu_ZA" > > > > > cleanEx() > nameEx("stri_locale_set") > ### * stri_locale_set > > flush(stderr()); flush(stdout()) > > ### Name: stri_locale_set > ### Title: Set or Get Default Locale in 'stringi' > ### Aliases: stri_locale_set stri_locale_get > > ### ** Examples > > ## Not run: > ##D oldloc <- stri_locale_set('pt_BR') > ##D # ... some locale-dependent operations > ##D # ... note that you may always modify a locale per-call > ##D # ... changing the default locale is convenient if you perform > ##D # ... many operations > ##D stri_locale_set(oldloc) # restore the previous default locale > ## End(Not run) > > > > cleanEx() > nameEx("stri_locate") > ### * stri_locate > > flush(stderr()); flush(stdout()) > > ### Name: stri_locate_all > ### Title: Locate Pattern Occurrences > ### Aliases: stri_locate_all stri_locate_first stri_locate_last stri_locate > ### stri_locate_all_charclass stri_locate_first_charclass > ### stri_locate_last_charclass stri_locate_all_coll > ### stri_locate_first_coll stri_locate_last_coll stri_locate_all_regex > ### stri_locate_first_regex stri_locate_last_regex stri_locate_all_fixed > ### stri_locate_first_fixed stri_locate_last_fixed > > ### ** Examples > > stri_locate_all('stringi', fixed='i') [[1]] start end [1,] 4 4 [2,] 7 7 > > stri_locate_first_coll('hladn\u00FD', 'HLADNY', strength=1, locale='sk_SK') start end [1,] 1 6 > > stri_locate_all_regex( + c('breakfast=eggs;lunch=pizza', 'breakfast=spam', 'no food here'), + '(?\\w+)=(?\\w+)', + capture_groups=TRUE + ) # named capture groups icu74/i18n/rematch.cpp:4461:31: runtime error: index 3 out of bounds for type 'long int [1]' #0 0x7bddf4f3b793 in icu_74_stringi::RegexMatcher::MatchChunkAt(int, signed char, UErrorCode&) icu74/i18n/rematch.cpp:4461 #1 0x7bddf4e93ed0 in icu_74_stringi::RegexMatcher::findUsingChunk(UErrorCode&) icu74/i18n/rematch.cpp:1026 #2 0x7bddf38e5026 in stri_locate_all_regex(SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_locate.cpp:196 #3 0x00000075d2ee in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:770 #4 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #5 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #6 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #7 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #8 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #9 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #10 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #11 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #12 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #13 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #14 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #15 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #16 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #17 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #18 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) icu74/i18n/rematch.cpp:581:43: runtime error: index 1 out of bounds for type 'long int [1]' #0 0x7bddf4e8b722 in icu_74_stringi::RegexMatcher::end64(int, UErrorCode&) const icu74/i18n/rematch.cpp:581 #1 0x7bddf4e8c054 in icu_74_stringi::RegexMatcher::end(int, UErrorCode&) const icu74/i18n/rematch.cpp:588 #2 0x7bddf38e57cf in stri_locate_all_regex(SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_locate.cpp:211 #3 0x00000075d2ee in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:770 #4 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #5 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #6 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #7 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #8 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #9 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #10 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #11 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #12 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #13 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #14 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #15 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #16 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #17 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #18 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) icu74/i18n/rematch.cpp:2315:39: runtime error: index 3 out of bounds for type 'long int [1]' #0 0x7bddf4eb6903 in icu_74_stringi::RegexMatcher::start64(int, UErrorCode&) const icu74/i18n/rematch.cpp:2315 #1 0x7bddf4eb7444 in icu_74_stringi::RegexMatcher::start(int, UErrorCode&) const icu74/i18n/rematch.cpp:2323 #2 0x7bddf38e56d6 in stri_locate_all_regex(SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_locate.cpp:209 #3 0x00000075d2ee in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:770 #4 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #5 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #6 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #7 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #8 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #9 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #10 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #11 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #12 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #13 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #14 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #15 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #16 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #17 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #18 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) [[1]] start end [1,] 1 14 [2,] 16 26 attr(,"capture_groups") attr(,"capture_groups")$when start end [1,] 1 9 [2,] 16 20 attr(,"capture_groups")$what start end [1,] 11 14 [2,] 22 26 [[2]] start end [1,] 1 14 attr(,"capture_groups") attr(,"capture_groups")$when start end [1,] 1 9 attr(,"capture_groups")$what start end [1,] 11 14 [[3]] start end [1,] NA NA attr(,"capture_groups") attr(,"capture_groups")$when start end [1,] NA NA attr(,"capture_groups")$what start end [1,] NA NA > > stri_locate_all_fixed("abababa", "ABA", case_insensitive=TRUE, overlap=TRUE) [[1]] start end [1,] 1 3 [2,] 3 5 [3,] 5 7 > stri_locate_first_fixed("ababa", "aba") start end [1,] 1 3 > stri_locate_last_fixed("ababa", "aba") # starts from end start end [1,] 3 5 > stri_locate_last_regex("ababa", "aba") # no overlaps, from left to right start end [1,] 1 3 > > x <- c("yes yes", "no", NA) > stri_locate_all_fixed(x, "yes") [[1]] start end [1,] 1 3 [2,] 5 7 [[2]] start end [1,] NA NA [[3]] start end [1,] NA NA > stri_locate_all_fixed(x, "yes", omit_no_match=TRUE) [[1]] start end [1,] 1 3 [2,] 5 7 [[2]] start end [[3]] start end [1,] NA NA > stri_locate_all_fixed(x, "yes", get_length=TRUE) [[1]] start length [1,] 1 3 [2,] 5 3 [[2]] start length [1,] -1 -1 [[3]] start length [1,] NA NA > stri_locate_all_fixed(x, "yes", get_length=TRUE, omit_no_match=TRUE) [[1]] start length [1,] 1 3 [2,] 5 3 [[2]] start length [[3]] start length [1,] NA NA > stri_locate_first_fixed(x, "yes") start end [1,] 1 3 [2,] NA NA [3,] NA NA > stri_locate_first_fixed(x, "yes", get_length=TRUE) start length [1,] 1 3 [2,] -1 -1 [3,] NA NA > > # Use regex positive-lookahead to locate overlapping pattern matches: > stri_locate_all_regex('ACAGAGACTTTAGATAGAGAAGA', '(?=AGA)') [[1]] start end [1,] 3 2 [2,] 5 4 [3,] 12 11 [4,] 16 15 [5,] 18 17 [6,] 21 20 > # note that start > end here (match of length zero) > > > > > > cleanEx() > nameEx("stri_locate_boundaries") > ### * stri_locate_boundaries > > flush(stderr()); flush(stdout()) > > ### Name: stri_locate_all_boundaries > ### Title: Locate Text Boundaries > ### Aliases: stri_locate_all_boundaries stri_locate_last_boundaries > ### stri_locate_first_boundaries stri_locate_all_words > ### stri_locate_last_words stri_locate_first_words > > ### ** Examples > > test <- 'The\u00a0above-mentioned features are very useful. Spam, spam, eggs, bacon, and spam.' > stri_locate_all_words(test) [[1]] start end [1,] 1 3 [2,] 5 9 [3,] 11 19 [4,] 24 31 [5,] 33 35 [6,] 37 40 [7,] 42 47 [8,] 50 53 [9,] 56 59 [10,] 62 65 [11,] 68 72 [12,] 75 77 [13,] 79 82 > stri_locate_all_boundaries( + 'Mr. Jones and Mrs. Brown are very happy. So am I, Prof. Smith.', + type='sentence', + locale='en_US@ss=standard' # ICU >= 56 only + ) [[1]] start end [1,] 1 41 [2,] 42 62 > > > > > > > cleanEx() > nameEx("stri_match") > ### * stri_match > > flush(stderr()); flush(stdout()) > > ### Name: stri_match_all > ### Title: Extract Regex Pattern Matches, Together with Capture Groups > ### Aliases: stri_match_all stri_match_first stri_match_last stri_match > ### stri_match_all_regex stri_match_first_regex stri_match_last_regex > > ### ** Examples > > stri_match_all_regex('breakfast=eggs, lunch=pizza, dessert=icecream', + '(\\w+)=(\\w+)') icu74/i18n/rematch.cpp:2947:33: runtime error: index 2 out of bounds for type 'long int [1]' #0 0x7bddf4f07949 in icu_74_stringi::RegexMatcher::MatchAt(long, signed char, UErrorCode&) icu74/i18n/rematch.cpp:2947 #1 0x7bddf4e9ce07 in icu_74_stringi::RegexMatcher::find(UErrorCode&) icu74/i18n/rematch.cpp:752 #2 0x7bddf4e9ce07 in icu_74_stringi::RegexMatcher::find(UErrorCode&) icu74/i18n/rematch.cpp:628 #3 0x7bddf3904e65 in stri_match_all_regex(SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_match.cpp:320 #4 0x00000075d392 in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:766 #5 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #6 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #7 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #8 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #9 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #10 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #11 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #12 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #13 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #14 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #15 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #16 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #17 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #18 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #19 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) icu74/i18n/rematch.cpp:2954:57: runtime error: index 2 out of bounds for type 'long int [1]' #0 0x7bddf4f076d5 in icu_74_stringi::RegexMatcher::MatchAt(long, signed char, UErrorCode&) icu74/i18n/rematch.cpp:2954 #1 0x7bddf4e9ce07 in icu_74_stringi::RegexMatcher::find(UErrorCode&) icu74/i18n/rematch.cpp:752 #2 0x7bddf4e9ce07 in icu_74_stringi::RegexMatcher::find(UErrorCode&) icu74/i18n/rematch.cpp:628 #3 0x7bddf3904e65 in stri_match_all_regex(SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_match.cpp:320 #4 0x00000075d392 in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:766 #5 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #6 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #7 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #8 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #9 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #10 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #11 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #12 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #13 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #14 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #15 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #16 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #17 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #18 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #19 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) icu74/i18n/rematch.cpp:2955:33: runtime error: index 1 out of bounds for type 'long int [1]' #0 0x7bddf4f075cc in icu_74_stringi::RegexMatcher::MatchAt(long, signed char, UErrorCode&) icu74/i18n/rematch.cpp:2955 #1 0x7bddf4e9ce07 in icu_74_stringi::RegexMatcher::find(UErrorCode&) icu74/i18n/rematch.cpp:752 #2 0x7bddf4e9ce07 in icu_74_stringi::RegexMatcher::find(UErrorCode&) icu74/i18n/rematch.cpp:628 #3 0x7bddf3904e65 in stri_match_all_regex(SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_match.cpp:320 #4 0x00000075d392 in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:766 #5 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #6 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #7 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #8 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #9 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #10 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #11 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #12 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #13 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #14 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #15 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #16 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #17 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #18 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #19 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) icu74/i18n/rematch.cpp:2954:31: runtime error: index 3 out of bounds for type 'long int [1]' #0 0x7bddf4f11895 in icu_74_stringi::RegexMatcher::MatchAt(long, signed char, UErrorCode&) icu74/i18n/rematch.cpp:2954 #1 0x7bddf4e9ce07 in icu_74_stringi::RegexMatcher::find(UErrorCode&) icu74/i18n/rematch.cpp:752 #2 0x7bddf4e9ce07 in icu_74_stringi::RegexMatcher::find(UErrorCode&) icu74/i18n/rematch.cpp:628 #3 0x7bddf3904e65 in stri_match_all_regex(SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_match.cpp:320 #4 0x00000075d392 in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:766 #5 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #6 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #7 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #8 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #9 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #10 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #11 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #12 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #13 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #14 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #15 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #16 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #17 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #18 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #19 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) [[1]] [,1] [,2] [,3] [1,] "breakfast=eggs" "breakfast" "eggs" [2,] "lunch=pizza" "lunch" "pizza" [3,] "dessert=icecream" "dessert" "icecream" > stri_match_all_regex(c('breakfast=eggs', 'lunch=pizza', 'no food here'), + '(\\w+)=(\\w+)') [[1]] [,1] [,2] [,3] [1,] "breakfast=eggs" "breakfast" "eggs" [[2]] [,1] [,2] [,3] [1,] "lunch=pizza" "lunch" "pizza" [[3]] [,1] [,2] [,3] [1,] NA NA NA > stri_match_all_regex(c('breakfast=eggs;lunch=pizza', + 'breakfast=bacon;lunch=spaghetti', 'no food here'), + '(\\w+)=(\\w+)') [[1]] [,1] [,2] [,3] [1,] "breakfast=eggs" "breakfast" "eggs" [2,] "lunch=pizza" "lunch" "pizza" [[2]] [,1] [,2] [,3] [1,] "breakfast=bacon" "breakfast" "bacon" [2,] "lunch=spaghetti" "lunch" "spaghetti" [[3]] [,1] [,2] [,3] [1,] NA NA NA > stri_match_all_regex(c('breakfast=eggs;lunch=pizza', + 'breakfast=bacon;lunch=spaghetti', 'no food here'), + '(?\\w+)=(?\\w+)') # named capture groups [[1]] when what [1,] "breakfast=eggs" "breakfast" "eggs" [2,] "lunch=pizza" "lunch" "pizza" [[2]] when what [1,] "breakfast=bacon" "breakfast" "bacon" [2,] "lunch=spaghetti" "lunch" "spaghetti" [[3]] when what [1,] NA NA NA > stri_match_first_regex(c('breakfast=eggs;lunch=pizza', + 'breakfast=bacon;lunch=spaghetti', 'no food here'), + '(\\w+)=(\\w+)') [,1] [,2] [,3] [1,] "breakfast=eggs" "breakfast" "eggs" [2,] "breakfast=bacon" "breakfast" "bacon" [3,] NA NA NA > stri_match_last_regex(c('breakfast=eggs;lunch=pizza', + 'breakfast=bacon;lunch=spaghetti', 'no food here'), + '(\\w+)=(\\w+)') [,1] [,2] [,3] [1,] "lunch=pizza" "lunch" "pizza" [2,] "lunch=spaghetti" "lunch" "spaghetti" [3,] NA NA NA > > stri_match_first_regex(c('abcd', ':abcd', ':abcd:'), '^(:)?([^:]*)(:)?$') icu74/i18n/rematch.cpp:4132:36: runtime error: index 6 out of bounds for type 'long int [1]' #0 0x7bddf4f03dca in icu_74_stringi::RegexMatcher::MatchAt(long, signed char, UErrorCode&) icu74/i18n/rematch.cpp:4132 #1 0x7bddf4e9ee24 in icu_74_stringi::RegexMatcher::find(UErrorCode&) icu74/i18n/rematch.cpp:731 #2 0x7bddf4e9ee24 in icu_74_stringi::RegexMatcher::find(UErrorCode&) icu74/i18n/rematch.cpp:628 #3 0x7bddf38ff3f0 in stri__match_firstlast_regex(SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, bool) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_match.cpp:142 #4 0x00000075d416 in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:763 #5 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #6 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #7 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #8 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #9 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #10 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #11 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #12 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #13 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #14 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #15 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #16 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #17 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #18 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #19 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) [,1] [,2] [,3] [,4] [1,] "abcd" NA "abcd" NA [2,] ":abcd" ":" "abcd" NA [3,] ":abcd:" ":" "abcd" ":" > stri_match_first_regex(c('abcd', ':abcd', ':abcd:'), '^(:)?([^:]*)(:)?$', cg_missing='') [,1] [,2] [,3] [,4] [1,] "abcd" "" "abcd" "" [2,] ":abcd" ":" "abcd" "" [3,] ":abcd:" ":" "abcd" ":" > > # Match all the pattern of the form XYX, including overlapping matches: > stri_match_all_regex('ACAGAGACTTTAGATAGAGAAGA', '(?=(([ACGT])[ACGT]\\2))')[[1]][,2] icu74/i18n/rematch.cpp:3646:59: runtime error: index 3 out of bounds for type 'long int [1]' #0 0x7bddf4f060d9 in icu_74_stringi::RegexMatcher::MatchAt(long, signed char, UErrorCode&) icu74/i18n/rematch.cpp:3646 #1 0x7bddf4e9afb8 in icu_74_stringi::RegexMatcher::find(UErrorCode&) icu74/i18n/rematch.cpp:702 #2 0x7bddf4e9afb8 in icu_74_stringi::RegexMatcher::find(UErrorCode&) icu74/i18n/rematch.cpp:628 #3 0x7bddf3904e65 in stri_match_all_regex(SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_match.cpp:320 #4 0x00000075d392 in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:766 #5 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #6 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #7 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #8 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #9 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #10 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #11 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #12 0x000000d238d8 in R_DispatchOrEvalSP /data/localhost/ripley/R/svn/R-devel/src/main/subassign.c:1550 #13 0x000000d651a7 in do_subset2 /data/localhost/ripley/R/svn/R-devel/src/main/subset.c:943 #14 0x000000878996 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1230 #15 0x000000d238d8 in R_DispatchOrEvalSP /data/localhost/ripley/R/svn/R-devel/src/main/subassign.c:1550 #16 0x000000d62447 in do_subset /data/localhost/ripley/R/svn/R-devel/src/main/subset.c:691 #17 0x000000878996 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1230 #18 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #19 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #20 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #21 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #22 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #23 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #24 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #25 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) icu74/i18n/rematch.cpp:3647:61: runtime error: index 4 out of bounds for type 'long int [1]' #0 0x7bddf4f06047 in icu_74_stringi::RegexMatcher::MatchAt(long, signed char, UErrorCode&) icu74/i18n/rematch.cpp:3647 #1 0x7bddf4e9afb8 in icu_74_stringi::RegexMatcher::find(UErrorCode&) icu74/i18n/rematch.cpp:702 #2 0x7bddf4e9afb8 in icu_74_stringi::RegexMatcher::find(UErrorCode&) icu74/i18n/rematch.cpp:628 #3 0x7bddf3904e65 in stri_match_all_regex(SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_match.cpp:320 #4 0x00000075d392 in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:766 #5 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #6 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #7 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #8 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #9 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #10 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #11 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #12 0x000000d238d8 in R_DispatchOrEvalSP /data/localhost/ripley/R/svn/R-devel/src/main/subassign.c:1550 #13 0x000000d651a7 in do_subset2 /data/localhost/ripley/R/svn/R-devel/src/main/subset.c:943 #14 0x000000878996 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1230 #15 0x000000d238d8 in R_DispatchOrEvalSP /data/localhost/ripley/R/svn/R-devel/src/main/subassign.c:1550 #16 0x000000d62447 in do_subset /data/localhost/ripley/R/svn/R-devel/src/main/subset.c:691 #17 0x000000878996 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1230 #18 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #19 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #20 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #21 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #22 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #23 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #24 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #25 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) icu74/i18n/rematch.cpp:5131:59: runtime error: index 3 out of bounds for type 'long int [1]' #0 0x7bddf4f2d7fa in icu_74_stringi::RegexMatcher::MatchChunkAt(int, signed char, UErrorCode&) icu74/i18n/rematch.cpp:5131 #1 0x7bddf4e94209 in icu_74_stringi::RegexMatcher::findUsingChunk(UErrorCode&) icu74/i18n/rematch.cpp:983 #2 0x7bddf3904e65 in stri_match_all_regex(SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_match.cpp:320 #3 0x00000075d392 in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:766 #4 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #5 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #6 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #7 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #8 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #9 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #10 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #11 0x000000d238d8 in R_DispatchOrEvalSP /data/localhost/ripley/R/svn/R-devel/src/main/subassign.c:1550 #12 0x000000d651a7 in do_subset2 /data/localhost/ripley/R/svn/R-devel/src/main/subset.c:943 #13 0x000000878996 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1230 #14 0x000000d238d8 in R_DispatchOrEvalSP /data/localhost/ripley/R/svn/R-devel/src/main/subassign.c:1550 #15 0x000000d62447 in do_subset /data/localhost/ripley/R/svn/R-devel/src/main/subset.c:691 #16 0x000000878996 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1230 #17 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #18 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #19 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #20 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #21 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #22 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #23 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #24 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) icu74/i18n/rematch.cpp:5132:61: runtime error: index 4 out of bounds for type 'long int [1]' #0 0x7bddf4f38008 in icu_74_stringi::RegexMatcher::MatchChunkAt(int, signed char, UErrorCode&) icu74/i18n/rematch.cpp:5132 #1 0x7bddf4e94209 in icu_74_stringi::RegexMatcher::findUsingChunk(UErrorCode&) icu74/i18n/rematch.cpp:983 #2 0x7bddf3904e65 in stri_match_all_regex(SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_match.cpp:320 #3 0x00000075d392 in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:766 #4 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #5 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #6 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #7 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #8 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #9 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #10 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #11 0x000000d238d8 in R_DispatchOrEvalSP /data/localhost/ripley/R/svn/R-devel/src/main/subassign.c:1550 #12 0x000000d651a7 in do_subset2 /data/localhost/ripley/R/svn/R-devel/src/main/subset.c:943 #13 0x000000878996 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1230 #14 0x000000d238d8 in R_DispatchOrEvalSP /data/localhost/ripley/R/svn/R-devel/src/main/subassign.c:1550 #15 0x000000d62447 in do_subset /data/localhost/ripley/R/svn/R-devel/src/main/subset.c:691 #16 0x000000878996 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1230 #17 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #18 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #19 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #20 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #21 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #22 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #23 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #24 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) [1] "ACA" "AGA" "GAG" "AGA" "TTT" "AGA" "ATA" "AGA" "GAG" "AGA" "AGA" > # Compare the above to: > stri_extract_all_regex('ACAGAGACTTTAGATAGAGAAGA', '([ACGT])[ACGT]\\1') [[1]] [1] "ACA" "GAG" "TTT" "AGA" "AGA" "AGA" > > > > > cleanEx() > nameEx("stri_na2empty") > ### * stri_na2empty > > flush(stderr()); flush(stdout()) > > ### Name: stri_na2empty > ### Title: Replace NAs with Empty Strings > ### Aliases: stri_na2empty > > ### ** Examples > > stri_na2empty(c('a', NA, '', 'b')) [1] "a" "" "" "b" > > > > > cleanEx() > nameEx("stri_numbytes") > ### * stri_numbytes > > flush(stderr()); flush(stdout()) > > ### Name: stri_numbytes > ### Title: Count the Number of Bytes > ### Aliases: stri_numbytes > > ### ** Examples > > stri_numbytes(letters) [1] 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 > stri_numbytes(c('abc', '123', '\u0105\u0104')) [1] 3 3 4 > > ## Not run: > ##D # this used to fail on Windows, where there were no native support > ##D # for 4-bytes Unicode characters; see, however, stri_unescape_unicode(): > ##D stri_numbytes('\U001F600') # compare stri_length('\U001F600') > ## End(Not run) > > > > > cleanEx() > nameEx("stri_opts_collator") > ### * stri_opts_collator > > flush(stderr()); flush(stdout()) > > ### Name: stri_opts_collator > ### Title: Generate a List with Collator Settings > ### Aliases: stri_opts_collator stri_coll > > ### ** Examples > > stri_cmp('number100', 'number2') [1] -1 > stri_cmp('number100', 'number2', opts_collator=stri_opts_collator(numeric=TRUE)) [1] 1 > stri_cmp('number100', 'number2', numeric=TRUE) # equivalent [1] 1 > stri_cmp('above mentioned', 'above-mentioned') [1] -1 > stri_cmp('above mentioned', 'above-mentioned', alternate_shifted=TRUE) [1] 0 > > > > cleanEx() > nameEx("stri_opts_fixed") > ### * stri_opts_fixed > > flush(stderr()); flush(stdout()) > > ### Name: stri_opts_fixed > ### Title: Generate a List with Fixed Pattern Search Engine's Settings > ### Aliases: stri_opts_fixed > > ### ** Examples > > stri_detect_fixed('ala', 'ALA') # case-sensitive by default [1] FALSE > stri_detect_fixed('ala', 'ALA', opts_fixed=stri_opts_fixed(case_insensitive=TRUE)) [1] TRUE > stri_detect_fixed('ala', 'ALA', case_insensitive=TRUE) # equivalent [1] TRUE > > > > cleanEx() > nameEx("stri_opts_regex") > ### * stri_opts_regex > > flush(stderr()); flush(stdout()) > > ### Name: stri_opts_regex > ### Title: Generate a List with Regex Matcher Settings > ### Aliases: stri_opts_regex > > ### ** Examples > > stri_detect_regex('ala', 'ALA') # case-sensitive by default [1] FALSE > stri_detect_regex('ala', 'ALA', opts_regex=stri_opts_regex(case_insensitive=TRUE)) [1] TRUE > stri_detect_regex('ala', 'ALA', case_insensitive=TRUE) # equivalent [1] TRUE > stri_detect_regex('ala', '(?i)ALA') # equivalent [1] TRUE > > > > cleanEx() > nameEx("stri_order") > ### * stri_order > > flush(stderr()); flush(stdout()) > > ### Name: stri_order > ### Title: Ordering Permutation > ### Aliases: stri_order > > ### ** Examples > > stri_order(c('hladny', 'chladny'), locale='pl_PL') [1] 2 1 > stri_order(c('hladny', 'chladny'), locale='sk_SK') [1] 1 2 > > stri_order(c(1, 100, 2, 101, 11, 10)) # lexicographic order [1] 1 6 2 4 5 3 > stri_order(c(1, 100, 2, 101, 11, 10), numeric=TRUE) # OK for integers [1] 1 3 6 5 2 4 > stri_order(c(0.25, 0.5, 1, -1, -2, -3), numeric=TRUE) # incorrect [1] 4 5 6 2 1 3 > > > > cleanEx() > nameEx("stri_pad") > ### * stri_pad > > flush(stderr()); flush(stdout()) > > ### Name: stri_pad_both > ### Title: Pad (Center/Left/Right Align) a String > ### Aliases: stri_pad_both stri_pad_left stri_pad_right stri_pad > > ### ** Examples > > stri_pad_left('stringi', 10, pad='#') [1] "###stringi" > stri_pad_both('stringi', 8:12, pad='*') [1] "stringi*" "*stringi*" "*stringi**" "**stringi**" "**stringi***" > # center on screen: > cat(stri_pad_both(c('the', 'string', 'processing', 'package'), + getOption('width')*0.9), sep='\n') the string processing package > cat(stri_pad_both(c('\ud6c8\ubbfc\uc815\uc74c', # takes width into account + stri_trans_nfkd('\ud6c8\ubbfc\uc815\uc74c'), 'abcd'), + width=10), sep='\n') 훈민정음 훈민정음 abcd > > > > > cleanEx() > nameEx("stri_rand_lipsum") > ### * stri_rand_lipsum > > flush(stderr()); flush(stdout()) > > ### Name: stri_rand_lipsum > ### Title: A Lorem Ipsum Generator > ### Aliases: stri_rand_lipsum > > ### ** Examples > > cat(sapply( + stri_wrap(stri_rand_lipsum(10), 80, simplify=FALSE), + stri_flatten, collapse='\n'), sep='\n\n') Lorem ipsum dolor sit amet, finibus torquent diam lobortis dolor ac eget neque sapien habitant tortor aliquam, nulla. Aliquet elit nec in quisque luctus amet in ac. Ante amet vestibulum, sit quis sit. Risus rhoncus sed urna dignissim sapien in eu aliquam nec! Eu mauris mauris, eu, facilisi, ipsum dui dapibus et ac in. Taciti, phasellus et augue lorem sapien, dictumst amet. Viverra ut erat non vel placerat consectetur, nunc. Augue ut ligula penatibus porttitor consequat tincidunt eros hac morbi magnis. Mattis pretium nunc finibus curae vestibulum erat mattis ut nibh. Purus nec massa penatibus dictumst amet pharetra nisl accumsan nunc diam. Amet sapien fermentum, sem, in pretium magna facilisi nulla cras. Ut hendrerit diam ac donec vehicula nulla tellus. Vehicula ut. Elit efficitur quam mi felis taciti a mauris magna donec. Bibendum amet augue enim felis ultrices adipiscing, a. Vitae suscipit convallis ac natoque non non sociosqu. Dui nec ligula nullam. Tincidunt ligula non ultrices sit montes potenti. Primis fermentum, sapien mollis, sed senectus habitasse egestas vulputate. Posuere imperdiet risus augue pellentesque duis rutrum mi arcu nullam, non turpis. Eros ut torquent vehicula dignissim habitant ut ante. Pharetra et ultricies feugiat in dolor litora, in vestibulum. Neque maximus quis justo nibh primis ac, ut! Natoque purus sapien amet. In ultrices varius curae lobortis in nec. Risus sed, purus quis, netus nam, nec. Risus, commodo lorem montes iaculis erat ac vitae. Bibendum mi neque duis finibus, nec integer cum, tellus tempor sit. Sed fusce eu sed, netus vestibulum nec erat lorem mi. Metus cras in lectus commodo ultrices nullam diam. Penatibus eros integer facilisis libero fringilla quam. Sed porta nam sit malesuada pharetra donec ex venenatis aenean. Ligula eu nisl taciti curabitur facilisis mus habitasse lobortis, sed. Donec nulla ac in sapien donec. Amet porttitor erat montes ullamcorper, ipsum! Vel, ac hac ante felis scelerisque semper orci sed. Class rhoncus nisl et in euismod, venenatis ullamcorper eu turpis. Scelerisque class efficitur vitae malesuada nulla mus, nec. Magna eget et venenatis tortor, lacinia, eros placerat sodales ligula, dis. Malesuada sed blandit magna ut urna nascetur aenean lectus. Vitae mollis, ullamcorper convallis tristique dolor. Augue ante est viverra taciti non dictum, sociis sociis. Ligula velit dis et habitant. Turpis libero pharetra iaculis eros non turpis auctor in integer at, pharetra. Eu ipsum porttitor eget ex, sem, netus vivamus sapien tincidunt venenatis lacus tincidunt et. In commodo lacinia aptent pellentesque torquent vel. Posuere mauris sed praesent eleifend. Senectus, accumsan sagittis nibh velit odio et vel tellus dictum. Molestie sapien ultricies in porttitor egestas tellus himenaeos. Vel sapien lacinia pulvinar tortor venenatis tortor, tempor magna nibh, ac vestibulum nulla pulvinar mollis. Non arcu blandit tempor nisl justo sed litora. Ut dui euismod blandit justo suspendisse, congue nec penatibus diam. Taciti, ad dictum accumsan tristique ut justo urna. Primis, iaculis fermentum diam, ac pretium. Mi enim sed non justo, pulvinar sed lobortis aptent. Imperdiet quis integer. Donec, varius enim in porta, faucibus dictum in, iaculis vestibulum, nulla convallis. Ut in ligula tempus maximus nunc at ante. Diam proin ac accumsan neque ad faucibus eu purus sit mi mauris nascetur est condimentum. Nec, molestie at amet nec felis porta fusce aenean. Risus euismod sed hac, ex enim. Sed, quisque at platea class iaculis scelerisque diam bibendum nec. Luctus, vestibulum, lacus in amet. In primis turpis metus. Porttitor vitae arcu gravida ligula vivamus sed penatibus laoreet. Nunc accumsan ligula cum donec sed ligula. Nisl egestas mus nisl tempus sociosqu, inceptos vitae. Nam ligula, lectus laoreet euismod semper sed mauris. Nibh pellentesque porta elit, conubia sagittis. Mollis erat varius, ut fringilla montes. Tempor nostra eu vitae sem risus mi in. Malesuada nam ligula cum laoreet in facilisi, mauris sed quis consectetur eget. A sed quis. Duis sed, in erat sem elementum fermentum ut justo ridiculus. Viverra mauris sem, sed quis lacus, feugiat dictumst ipsum. Primis nascetur potenti augue, aliquet curabitur accumsan massa, ipsum, sed ut. Ut sed donec ac volutpat sed sed. Nec convallis ornare nunc sit, mauris in in non. Ut in tortor congue duis ut sed purus nec. Consectetur imperdiet hendrerit ipsum penatibus cubilia. In per euismod fermentum id tempor enim maximus sociosqu vitae nunc sodales. Dictum torquent lorem praesent, tincidunt at, litora in leo lacus magna. Lacinia facilisis conubia euismod et amet maecenas fringilla volutpat quis. Etiam sit sem sed egestas purus eu porttitor, pellentesque vitae egestas per, dictumst. Scelerisque habitasse pharetra mi, natoque non ut sed nisi efficitur. Ultricies eu nec, dictumst. Erat sit risus tempus ipsum platea. Urna eu mi luctus. Vel, eu condimentum ex nulla sit quis. Urna eleifend nisl, montes ac in. Tempor varius placerat ullamcorper primis dui ut hac. Erat fames, fusce vestibulum, eu. Nunc sed euismod amet sagittis nec ornare metus. Nunc turpis imperdiet volutpat diam donec. Parturient malesuada vel egestas arcu etiam non a nec nisi tempor sit eros. Massa tincidunt, dolor netus in libero purus class dignissim nec. Dictum eros suspendisse ut ac sociosqu dignissim nec urna taciti ipsum. Nec dis lorem mauris sed luctus eros ad tempor. Porta sed ante nisl donec nibh maecenas sed efficitur, viverra dui ac class. Leo diam iaculis vitae vestibulum imperdiet. Rhoncus, sed faucibus ullamcorper torquent commodo eget. Leo ac eu maecenas turpis justo netus nisl, a commodo sed eleifend. Congue dui pellentesque sodales pellentesque condimentum. Ac suscipit augue, proin facilisis ad nulla. Est nunc ipsum bibendum ac eros eros. Mi, amet nunc nullam cursus justo nec. Id ultricies nec, congue tortor aliquam nulla. Ultricies et vehicula ut, nam, bibendum adipiscing eget sed. Mauris ac nisl ut nulla odio, ipsum. Primis ante magnis nunc eleifend, eu. Mattis finibus purus lacus dapibus ut malesuada congue mauris in nisl turpis. Est nisl, inceptos amet non nisi sed! Ut mollis habitant at malesuada ipsum, montes. Cursus feugiat mauris in nibh feugiat habitant phasellus. > cat(stri_rand_lipsum(10), sep='\n\n') Lorem ipsum dolor sit amet, maximus habitasse et fames donec. Diam amet, ligula, amet ullamcorper a potenti. Donec, nostra neque odio sodales at, pellentesque bibendum vel, integer. Cum nunc placerat non facilisis est. Montes ex. Nec, eros adipiscing non, sollicitudin vel luctus posuere. Scelerisque, dictum, tortor elementum lacus eget in mi rhoncus, eu. Cubilia viverra facilisi sed odio. Erat lorem eros orci quis fringilla, habitasse. Taciti curae ultrices pellentesque. Molestie lacinia, sem, auctor commodo phasellus etiam commodo. Platea eget, risus sed eget ipsum phasellus vulputate. Turpis nulla sodales auctor elementum mauris aptent tellus. Amet dapibus ac urna senectus non. Tellus dignissim amet diam non et? Id vitae consectetur libero, vestibulum vel conubia sed blandit non varius. Lacus augue tortor, nisl taciti mi vitae, fusce. Sit et vitae praesent convallis nibh sit. Pulvinar purus risus facilisi et. Et ex vel quis. Aliquam semper in vel orci sed sed vel turpis id. Sit vel a eros molestie nulla quisque. Turpis nascetur auctor sagittis. Ac lectus condimentum quis neque massa dolor. Maximus sed nisl ante ut id ornare. Ultricies vel inceptos, et per arcu. Eu, donec, at venenatis quam, donec non molestie in. Nisi aliquet varius urna leo scelerisque etiam ac, aliquam nibh eget ac, massa. Vel varius volutpat, sociis at vitae nec congue et lacus, ut. Netus vel iaculis montes laoreet, eget nisi eu, amet, ut nunc purus. Iaculis, turpis non interdum sollicitudin nisl et. Gravida ac ornare eu morbi libero blandit, bibendum molestie in diam. Turpis rutrum, urna mi in eget erat, ac. Justo vitae integer a vulputate nam, et risus eu quis a sit, sed, habitant ac. Eros congue et turpis donec, condimentum, libero aliquet? Suscipit mauris quam aliquam, tempus penatibus non. Nibh aliquet tellus pharetra fringilla pulvinar. Est netus suspendisse odio ac nisl, adipiscing mauris mauris nulla? Ac amet id malesuada nascetur ut sed in magna eget ac praesent non faucibus. Dui tincidunt dapibus vulputate magnis nibh turpis lacus lacinia. Urna sed praesent suspendisse, ad dis ad. Duis vehicula quam auctor mi penatibus nulla adipiscing dapibus, class lacinia leo torquent non. Sed varius dui id nulla maximus. Velit id, nisl euismod a, cubilia nisi convallis, a rhoncus in. Arcu praesent cubilia erat quam magna inceptos. Dolor primis ac, felis scelerisque. Sed auctor sapien ut accumsan maximus et erat et posuere, cursus eros. Sed maximus volutpat. Conubia velit natoque, eget non, tortor lacus. Metus ut blandit dapibus faucibus luctus, vestibulum id. Interdum nec inceptos dictumst vulputate augue torquent. Luctus velit vel. Consectetur habitant duis sollicitudin a tempus. At libero penatibus. Curabitur, vel erat venenatis purus velit sed eu accumsan in platea, ac porttitor sed. Ut sit? Ultricies proin. Fermentum nulla malesuada mus libero enim fermentum amet aliquam nisl. In nulla nam ipsum interdum tortor praesent, libero ac condimentum in. Imperdiet in pretium pretium lectus morbi at. A phasellus purus nullam ut turpis gravida. Ligula in bibendum suspendisse conubia finibus tempus risus ligula odio. Dis quis et eget amet urna curabitur risus amet erat viverra senectus. Amet egestas imperdiet. Mus enim eu viverra gravida class, imperdiet lorem ut scelerisque, torquent sed. Et erat non ac id massa non augue egestas. Eros nulla justo quam, venenatis egestas mi. Sed parturient donec sed, egestas maecenas id facilisi ut eu quis at. Cum turpis eros libero nulla eros, mi aliquam sed ridiculus ac. Faucibus fringilla bibendum maximus sed aliquam semper dui aptent curae tincidunt sed. Leo rhoncus magnis fermentum arcu, scelerisque integer. Cursus consectetur, purus mi proin nisl phasellus ut venenatis sed. Ac augue dapibus lobortis potenti pellentesque tempus sodales nec. Dapibus dignissim nibh sed metus ac. Ad mauris porttitor, nibh congue magnis eleifend sed mus neque pharetra in nec. Facilisis aliquam luctus volutpat in velit tincidunt enim. Egestas vulputate magnis mauris venenatis sed cum adipiscing. Viverra, lacinia vestibulum morbi cras ante molestie pharetra, varius sed. Conubia maecenas lectus dapibus senectus, sit purus vestibulum, lacus. Conubia rhoncus dapibus elementum erat in? Malesuada mauris et eu dignissim ullamcorper sed eu. Nec diam dictum placerat fusce, sed in at, fermentum, posuere elementum non sem dictum quis facilisis. Vel ante suspendisse lacus hendrerit tellus, ut eu. Non praesent dis, fames ac posuere sed. Efficitur, dui nunc ex platea tempor, torquent, sit dolor ex. Vel, enim lacinia euismod egestas luctus turpis quisque felis. Auctor velit ultrices dapibus condimentum pulvinar. Sed, a efficitur aptent et. Nullam maecenas habitant aptent sed ipsum molestie at sem quam urna. Primis libero, pharetra maecenas suspendisse in vestibulum dolor. Vestibulum libero purus posuere in nibh per, metus nibh. Magna sed volutpat augue et eros, in. Sed a adipiscing. In eu taciti et primis phasellus sed integer. Arcu justo praesent volutpat in eu leo convallis nisl porttitor lobortis pharetra massa rhoncus efficitur. Placerat adipiscing a vivamus. Eleifend vestibulum nec, pulvinar curae. Vivamus accumsan mattis, sem. Lorem tincidunt sed leo adipiscing eu, scelerisque. Tortor, nascetur consectetur conubia pellentesque auctor, at, integer in finibus nam pulvinar. Elementum cursus magna netus id, ac interdum sed. Ut donec ut imperdiet, ut ipsum egestas. Nisl aliquet lobortis finibus. A id aliquam nostra est eu non, tincidunt. Sociis a sed, felis cursus in sed etiam et hendrerit dignissim. Proin suspendisse quam, ornare fusce elit eleifend ex convallis nibh odio elementum nisi, sed sed. Ut vestibulum eu sagittis massa pharetra felis ac tempor amet ipsum id. Fringilla cubilia, est enim vestibulum. Quis posuere sed sed sed, odio. Sollicitudin lectus vel posuere cum ut sapien lacinia sed, dictum. Cubilia nunc eu sociis, pellentesque odio pharetra nascetur. > > > > > cleanEx() > nameEx("stri_rand_shuffle") > ### * stri_rand_shuffle > > flush(stderr()); flush(stdout()) > > ### Name: stri_rand_shuffle > ### Title: Randomly Shuffle Code Points in Each String > ### Aliases: stri_rand_shuffle > > ### ** Examples > > stri_rand_shuffle(c('abcdefghi', '0123456789')) [1] "cdgifbeah" "6134809257" > # you can do better than this with stri_rand_strings: > stri_rand_shuffle(rep(stri_paste(letters, collapse=''), 10)) [1] "zkuyisemojqdbtvcrlxhpnfawg" "uobvepagqxrcmlkhwfzdinyjts" [3] "tdxkwmfqychezslapjbruovnig" "qwuvonbstpezcjfmlgayrxkdhi" [5] "cmrzopjvqaneublfwdisxgyhkt" "ghtnbuixcsprakfdjqozwymvel" [7] "itkrwenoybvuaqgmcpjdszlhfx" "cyiqgwmveaspotudkxznblhrfj" [9] "yakjhlqbrncixfptwumsodvgze" "xelhndpyvfrusoqctzwibjgamk" > > > > > cleanEx() > nameEx("stri_rand_strings") > ### * stri_rand_strings > > flush(stderr()); flush(stdout()) > > ### Name: stri_rand_strings > ### Title: Generate Random Strings > ### Aliases: stri_rand_strings > > ### ** Examples > > stri_rand_strings(5, 10) # 5 strings of length 10 [1] "GNZuCtwed3" "CAgNlUizNm" "vDe7GN0NrL" "TbUBpfn6iP" "oemYWm1Tjg" > stri_rand_strings(5, sample(1:10, 5, replace=TRUE)) # 5 strings of random lengths [1] "JWfPuI" "SKeFTl5sL" "qLKTtrOm" "xQiOKkCi7" "F8E3dsm" > stri_rand_strings(10, 5, '[\\p{script=latin}&\\p{Ll}]') # small letters from the Latin script [1] "ꞌᴞʬꞟṵ" "ẹʀȴ𝼥ẛ" "ǝōᵴｅṭ" "𝼒ꜭʃᴌū" "jⱴĩᴗả" "𝼞ᶃᵺƙꝏ" "ᴝᶎǖǵṧ" "ṉāßầｈ" [9] "ṫḳᶚ𝼙ᶌ" "ợṱȅȣꜫ" > > # generate n random passwords of length in [8, 14] > # consisting of at least one digit, small and big ASCII letter: > n <- 10 > stri_rand_shuffle(stri_paste( + stri_rand_strings(n, 1, '[0-9]'), + stri_rand_strings(n, 1, '[a-z]'), + stri_rand_strings(n, 1, '[A-Z]'), + stri_rand_strings(n, sample(5:11, 5, replace=TRUE), '[a-zA-Z0-9]') + )) [1] "wVBssBle4Ki" "BXv1iOH6n" "IbaJqm6G7WBGD" "Yi1WS8Fh" [5] "fIx8Jwo6l" "hQ6VAxxLJeG" "xPVFVvq25" "LdWlSgYg38NOQ" [9] "84IuPuKZ" "wwQ8J5lSD" > > > > > cleanEx() > nameEx("stri_rank") > ### * stri_rank > > flush(stderr()); flush(stdout()) > > ### Name: stri_rank > ### Title: Ranking > ### Aliases: stri_rank > > ### ** Examples > > stri_rank(c('hladny', 'chladny'), locale='pl_PL') [1] 2 1 > stri_rank(c('hladny', 'chladny'), locale='sk_SK') [1] 1 2 > > stri_rank("a" %s+% c(1, 100, 2, 101, 11, 10)) # lexicographic order [1] 1 3 6 4 5 2 > stri_rank("a" %s+% c(1, 100, 2, 101, 11, 10), numeric=TRUE) # OK [1] 1 5 2 6 4 3 > stri_rank("a" %s+% c(0.25, 0.5, 1, -1, -2, -3), numeric=TRUE) # incorrect [1] 5 4 6 1 2 3 > > # Ordering a data frame with respect to two criteria: > X <- data.frame(a=c("b", NA, "b", "b", NA, "a", "a", "c"), b=runif(8)) > X[order(stri_rank(X$a), X$b), ] a b 6 a 0.8983897 7 a 0.9446753 1 b 0.2655087 3 b 0.5728534 4 b 0.9082078 8 c 0.6607978 5 0.2016819 2 0.3721239 > > > > > cleanEx() > nameEx("stri_remove_empty") > ### * stri_remove_empty > > flush(stderr()); flush(stdout()) > > ### Name: stri_remove_empty > ### Title: Remove All Empty Strings from a Character Vector > ### Aliases: stri_remove_empty stri_omit_empty stri_remove_empty_na > ### stri_omit_empty_na stri_remove_na stri_omit_na > > ### ** Examples > > stri_remove_empty(stri_na2empty(c('a', NA, '', 'b'))) [1] "a" "b" > stri_remove_empty(c('a', NA, '', 'b')) [1] "a" NA "b" > stri_remove_empty(c('a', NA, '', 'b'), TRUE) [1] "a" "b" > > stri_omit_empty_na(c('a', NA, '', 'b')) [1] "a" "b" > > > > > cleanEx() > nameEx("stri_replace") > ### * stri_replace > > flush(stderr()); flush(stdout()) > > ### Name: stri_replace_all > ### Title: Replace Pattern Occurrences > ### Aliases: stri_replace_all stri_replace_first stri_replace_last > ### stri_replace stri_replace_all_charclass stri_replace_first_charclass > ### stri_replace_last_charclass stri_replace_all_coll > ### stri_replace_first_coll stri_replace_last_coll stri_replace_all_fixed > ### stri_replace_first_fixed stri_replace_last_fixed > ### stri_replace_all_regex stri_replace_first_regex > ### stri_replace_last_regex > > ### ** Examples > > stri_replace_all_charclass('aaaa', '[a]', 'b', merge=c(TRUE, FALSE)) Warning in stri_replace_all_charclass("aaaa", "[a]", "b", merge = c(TRUE, : argument `merge` should be a single logical value; only the first element is used [1] "b" > > stri_replace_all_charclass('a\nb\tc d', '\\p{WHITE_SPACE}', ' ') [1] "a b c d" > stri_replace_all_charclass('a\nb\tc d', '\\p{WHITE_SPACE}', ' ', merge=TRUE) [1] "a b c d" > > s <- 'Lorem ipsum dolor sit amet, consectetur adipisicing elit.' > stri_replace_all_fixed(s, ' ', '#') [1] "Lorem#ipsum#dolor#sit#amet,#consectetur#adipisicing#elit." > stri_replace_all_fixed(s, 'o', '0') [1] "L0rem ipsum d0l0r sit amet, c0nsectetur adipisicing elit." > > stri_replace_all_fixed(c('1', 'NULL', '3'), 'NULL', NA) [1] "1" NA "3" > > stri_replace_all_regex(s, ' .*? ', '#') [1] "Lorem#dolor#amet,#adipisicing elit." > stri_replace_all_regex(s, '(el|s)it', '1234') [1] "Lorem ipsum dolor 1234 amet, consectetur adipisicing 1234." > stri_replace_all_regex('abaca', 'a', c('!', '*')) [1] "!b!c!" "*b*c*" > stri_replace_all_regex('123|456|789', '(\\p{N}).(\\p{N})', '$2-$1') icu74/i18n/rematch.cpp:1275:39: runtime error: index 3 out of bounds for type 'long int [1]' #0 0x7bddf4e9151c in icu_74_stringi::RegexMatcher::appendGroup(int, UText*, UErrorCode&) const icu74/i18n/rematch.cpp:1275 #1 0x7bddf4e6b049 in icu_74_stringi::RegexMatcher::appendReplacement(UText*, UText*, UErrorCode&) icu74/i18n/rematch.cpp:473 #2 0x7bddf4ebcf46 in icu_74_stringi::RegexMatcher::replaceAll(UText*, UText*, UErrorCode&) icu74/i18n/rematch.cpp:1741 #3 0x7bddf4ebe066 in icu_74_stringi::RegexMatcher::replaceAll(icu_74_stringi::UnicodeString const&, UErrorCode&) icu74/i18n/rematch.cpp:1708 #4 0x7bddf3909a5c in stri__replace_allfirstlast_regex(SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, int) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_replace.cpp:109 #5 0x00000075d392 in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:766 #6 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #7 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #8 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #9 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #10 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #11 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #12 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #13 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #14 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #15 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #16 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #17 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #18 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #19 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #20 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) icu74/i18n/rematch.cpp:1276:41: runtime error: index 4 out of bounds for type 'long int [1]' #0 0x7bddf4e91574 in icu_74_stringi::RegexMatcher::appendGroup(int, UText*, UErrorCode&) const icu74/i18n/rematch.cpp:1276 #1 0x7bddf4e6b049 in icu_74_stringi::RegexMatcher::appendReplacement(UText*, UText*, UErrorCode&) icu74/i18n/rematch.cpp:473 #2 0x7bddf4ebcf46 in icu_74_stringi::RegexMatcher::replaceAll(UText*, UText*, UErrorCode&) icu74/i18n/rematch.cpp:1741 #3 0x7bddf4ebe066 in icu_74_stringi::RegexMatcher::replaceAll(icu_74_stringi::UnicodeString const&, UErrorCode&) icu74/i18n/rematch.cpp:1708 #4 0x7bddf3909a5c in stri__replace_allfirstlast_regex(SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, int) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_replace.cpp:109 #5 0x00000075d392 in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:766 #6 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #7 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #8 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #9 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #10 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #11 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #12 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #13 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #14 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #15 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #16 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #17 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #18 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #19 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #20 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) [1] "3-1|6-4|9-7" > stri_replace_all_regex(c('stringi R', 'REXAMINE', '123'), '( R|R.)', ' r ') [1] "stringi r " " r XAMINE" "123" > > # named capture groups are available since ICU 55 > ## Not run: > ##D stri_replace_all_regex('words 123 and numbers 456', > ##D '(?[0-9]+)', '!${numbers}!') > ## End(Not run) > > # Compare the results: > stri_replace_all_fixed('The quick brown fox jumped over the lazy dog.', + c('quick', 'brown', 'fox'), c('slow', 'black', 'bear'), vectorize_all=TRUE) [1] "The slow brown fox jumped over the lazy dog." [2] "The quick black fox jumped over the lazy dog." [3] "The quick brown bear jumped over the lazy dog." > stri_replace_all_fixed('The quick brown fox jumped over the lazy dog.', + c('quick', 'brown', 'fox'), c('slow', 'black', 'bear'), vectorize_all=FALSE) [1] "The slow black bear jumped over the lazy dog." > > # Compare the results: > stri_replace_all_fixed('The quicker brown fox jumped over the lazy dog.', + c('quick', 'brown', 'fox'), c('slow', 'black', 'bear'), vectorize_all=FALSE) [1] "The slower black bear jumped over the lazy dog." > stri_replace_all_regex('The quicker brown fox jumped over the lazy dog.', + '\\b'%s+%c('quick', 'brown', 'fox')%s+%'\\b', c('slow', 'black', 'bear'), vectorize_all=FALSE) [1] "The quicker black bear jumped over the lazy dog." > > # Searching for the last occurrence: > # Note the difference - regex searches left to right, with no overlaps. > stri_replace_last_fixed("agAGA", "aga", "*", case_insensitive=TRUE) [1] "ag*" > stri_replace_last_regex("agAGA", "aga", "*", case_insensitive=TRUE) [1] "*GA" > > > > > cleanEx() > nameEx("stri_replace_na") > ### * stri_replace_na > > flush(stderr()); flush(stdout()) > > ### Name: stri_replace_na > ### Title: Replace Missing Values in a Character Vector > ### Aliases: stri_replace_na > > ### ** Examples > > x <- c('test', NA) > stri_paste(x, 1:2) # 'test1' NA [1] "test1" NA > paste(x, 1:2) # 'test 1' 'NA 2' [1] "test 1" "NA 2" > stri_paste(stri_replace_na(x), 1:2, sep=' ') # 'test 1' 'NA 2' [1] "test 1" "NA 2" > > > > > cleanEx() > nameEx("stri_reverse") > ### * stri_reverse > > flush(stderr()); flush(stdout()) > > ### Name: stri_reverse > ### Title: Reverse Each String > ### Aliases: stri_reverse > > ### ** Examples > > stri_reverse(c('123', 'abc d e f')) [1] "321" "f e d cba" > stri_reverse('ZXY (\u0105\u0104123$^).') [1] ".)^$321Ąą( YXZ" > stri_reverse(stri_trans_nfd('\u0105')) == stri_trans_nfd('\u0105') # A, ogonek -> agonek, A [1] FALSE > > > > > cleanEx() > nameEx("stri_sort") > ### * stri_sort > > flush(stderr()); flush(stdout()) > > ### Name: stri_sort > ### Title: String Sorting > ### Aliases: stri_sort > > ### ** Examples > > stri_sort(c('hladny', 'chladny'), locale='pl_PL') [1] "chladny" "hladny" > stri_sort(c('hladny', 'chladny'), locale='sk_SK') [1] "hladny" "chladny" > stri_sort(sample(LETTERS)) [1] "A" "B" "C" "D" "E" "F" "G" "H" "I" "J" "K" "L" "M" "N" "O" "P" "Q" "R" "S" [20] "T" "U" "V" "W" "X" "Y" "Z" > stri_sort(c(1, 100, 2, 101, 11, 10)) # lexicographic order [1] "1" "10" "100" "101" "11" "2" > stri_sort(c(1, 100, 2, 101, 11, 10), numeric=TRUE) # OK for integers [1] "1" "2" "10" "11" "100" "101" > stri_sort(c(0.25, 0.5, 1, -1, -2, -3), numeric=TRUE) # incorrect [1] "-1" "-2" "-3" "0.5" "0.25" "1" > > > > cleanEx() > nameEx("stri_sort_key") > ### * stri_sort_key > > flush(stderr()); flush(stdout()) > > ### Name: stri_sort_key > ### Title: Sort Keys > ### Aliases: stri_sort_key > > ### ** Examples > > stri_sort_key(c('hladny', 'chladny'), locale='pl_PL') [1] "8@*0DZ\001\n\001\n" ".8@*0DZ\001\v\001\v" > stri_sort_key(c('hladny', 'chladny'), locale='sk_SK') [1] "8@*0DZ\001\n\001\n" "9\002@*0DZ\001\n\001\n" > > > > > cleanEx() > nameEx("stri_split") > ### * stri_split > > flush(stderr()); flush(stdout()) > > ### Name: stri_split > ### Title: Split a String By Pattern Matches > ### Aliases: stri_split stri_split_fixed stri_split_regex stri_split_coll > ### stri_split_charclass > > ### ** Examples > > stri_split_fixed('a_b_c_d', '_') [[1]] [1] "a" "b" "c" "d" > stri_split_fixed('a_b_c__d', '_') [[1]] [1] "a" "b" "c" "" "d" > stri_split_fixed('a_b_c__d', '_', omit_empty=TRUE) [[1]] [1] "a" "b" "c" "d" > stri_split_fixed('a_b_c__d', '_', n=2, tokens_only=FALSE) # 'a' & remainder [[1]] [1] "a" "b_c__d" > stri_split_fixed('a_b_c__d', '_', n=2, tokens_only=TRUE) # 'a' & 'b' only [[1]] [1] "a" "b" > stri_split_fixed('a_b_c__d', '_', n=4, omit_empty=TRUE, tokens_only=TRUE) [[1]] [1] "a" "b" "c" "d" > stri_split_fixed('a_b_c__d', '_', n=4, omit_empty=FALSE, tokens_only=TRUE) [[1]] [1] "a" "b" "c" "" > stri_split_fixed('a_b_c__d', '_', omit_empty=NA) [[1]] [1] "a" "b" "c" NA "d" > stri_split_fixed(c('ab_c', 'd_ef_g', 'h', ''), '_', n=1, tokens_only=TRUE, omit_empty=TRUE) [[1]] [1] "ab" [[2]] [1] "d" [[3]] [1] "h" [[4]] character(0) > stri_split_fixed(c('ab_c', 'd_ef_g', 'h', ''), '_', n=2, tokens_only=TRUE, omit_empty=TRUE) [[1]] [1] "ab" "c" [[2]] [1] "d" "ef" [[3]] [1] "h" [[4]] character(0) > stri_split_fixed(c('ab_c', 'd_ef_g', 'h', ''), '_', n=3, tokens_only=TRUE, omit_empty=TRUE) [[1]] [1] "ab" "c" [[2]] [1] "d" "ef" "g" [[3]] [1] "h" [[4]] character(0) > > stri_list2matrix(stri_split_fixed(c('ab,c', 'd,ef,g', ',h', ''), ',', omit_empty=TRUE)) [,1] [,2] [,3] [,4] [1,] "ab" "d" "h" NA [2,] "c" "ef" NA NA [3,] NA "g" NA NA > stri_split_fixed(c('ab,c', 'd,ef,g', ',h', ''), ',', omit_empty=FALSE, simplify=TRUE) [,1] [,2] [,3] [1,] "ab" "c" "" [2,] "d" "ef" "g" [3,] "" "h" "" [4,] "" "" "" > stri_split_fixed(c('ab,c', 'd,ef,g', ',h', ''), ',', omit_empty=NA, simplify=TRUE) [,1] [,2] [,3] [1,] "ab" "c" "" [2,] "d" "ef" "g" [3,] NA "h" "" [4,] NA "" "" > stri_split_fixed(c('ab,c', 'd,ef,g', ',h', ''), ',', omit_empty=TRUE, simplify=TRUE) [,1] [,2] [,3] [1,] "ab" "c" "" [2,] "d" "ef" "g" [3,] "h" "" "" [4,] "" "" "" > stri_split_fixed(c('ab,c', 'd,ef,g', ',h', ''), ',', omit_empty=NA, simplify=NA) [,1] [,2] [,3] [1,] "ab" "c" NA [2,] "d" "ef" "g" [3,] NA "h" NA [4,] NA NA NA > > stri_split_regex(c('ab,c', 'd,ef , g', ', h', ''), + '\\p{WHITE_SPACE}*,\\p{WHITE_SPACE}*', omit_empty=NA, simplify=TRUE) icu74/i18n/rematch.cpp:5575:36: runtime error: index 1 out of bounds for type 'long int [1]' #0 0x7bddf4f3549c in icu_74_stringi::RegexMatcher::MatchChunkAt(int, signed char, UErrorCode&) icu74/i18n/rematch.cpp:5575 #1 0x7bddf4e93ed0 in icu_74_stringi::RegexMatcher::findUsingChunk(UErrorCode&) icu74/i18n/rematch.cpp:1026 #2 0x7bddf3926c4a in stri_split_regex(SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*, SEXPREC*) /data/localhost/ripley/R/packages/tests-gcc-SAN/stringi/src/stri_search_regex_split.cpp:154 #3 0x00000075d230 in R_doDotCall /data/localhost/ripley/R/svn/R-devel/src/main/dotcode.c:775 #4 0x0000008ff577 in bcEval_loop /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:8700 #5 0x0000008d687b in bcEval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:7533 #6 0x000000877eba in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1167 #7 0x00000088e6ca in R_execClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2398 #8 0x00000089235d in applyClosure_core /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2314 #9 0x000000878568 in Rf_applyClosure /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:2333 #10 0x000000878568 in Rf_eval /data/localhost/ripley/R/svn/R-devel/src/main/eval.c:1278 #11 0x000000a1ee48 in Rf_ReplIteration /data/localhost/ripley/R/svn/R-devel/src/main/main.c:264 #12 0x000000a1ee48 in R_ReplConsole /data/localhost/ripley/R/svn/R-devel/src/main/main.c:317 #13 0x000000a3cada in run_Rmainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1237 #14 0x000000a3cb72 in Rf_mainloop /data/localhost/ripley/R/svn/R-devel/src/main/main.c:1244 #15 0x000000411f5f in main /data/localhost/ripley/R/svn/R-devel/src/main/Rmain.c:29 #16 0x7fde06a0a680 in __libc_start_call_main (/lib64/libc.so.6+0x3680) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #17 0x7fde06a0a797 in __libc_start_main@GLIBC_2.2.5 (/lib64/libc.so.6+0x3797) (BuildId: 17f2e1fd905f485786f6fd6e3bede4ad737137e7) #18 0x000000412924 in _start (/data/localhost/ripley/R/gcc-SAN3/bin/exec/R+0x412924) (BuildId: 7bd069e7b1c3f2758f94ae347cb95ae3bb7314b6) [,1] [,2] [,3] [1,] "ab" "c" "" [2,] "d" "ef" "g" [3,] NA "h" "" [4,] NA "" "" > > stri_split_charclass('Lorem ipsum dolor sit amet', '\\p{WHITE_SPACE}') [[1]] [1] "Lorem" "ipsum" "dolor" "sit" "amet" > stri_split_charclass(' Lorem ipsum dolor', '\\p{WHITE_SPACE}', n=3, + omit_empty=c(FALSE, TRUE)) [[1]] [1] "" "Lorem" " ipsum dolor" [[2]] [1] "Lorem" "ipsum" "dolor" > > stri_split_regex('Lorem ipsum dolor sit amet', + '\\p{Z}+') # see also stri_split_charclass [[1]] [1] "Lorem" "ipsum" "dolor" "sit" "amet" > > > > > cleanEx() > nameEx("stri_split_boundaries") > ### * stri_split_boundaries > > flush(stderr()); flush(stdout()) > > ### Name: stri_split_boundaries > ### Title: Split a String at Text Boundaries > ### Aliases: stri_split_boundaries > > ### ** Examples > > test <- 'The\u00a0above-mentioned features are very useful. ' %s+% + 'Spam, spam, eggs, bacon, and spam. 123 456 789' > stri_split_boundaries(test, type='line') [[1]] [1] "The above-" "mentioned " "features " "are " [5] "very " "useful. " "Spam, " "spam, " [9] "eggs, " "bacon, " "and " "spam. " [13] "123 " "456 " "789" > stri_split_boundaries(test, type='word') [[1]] [1] "The" " " "above" "-" "mentioned" " " [7] "features" " " "are" " " "very" " " [13] "useful" "." " " "Spam" "," " " [19] "spam" "," " " "eggs" "," " " [25] "bacon" "," " " "and" " " "spam" [31] "." " " "123" " " "456" " " [37] "789" > stri_split_boundaries(test, type='word', skip_word_none=TRUE) [[1]] [1] "The" "above" "mentioned" "features" "are" "very" [7] "useful" "Spam" "spam" "eggs" "bacon" "and" [13] "spam" "123" "456" "789" > stri_split_boundaries(test, type='word', skip_word_none=TRUE, skip_word_letter=TRUE) [[1]] [1] "123" "456" "789" > stri_split_boundaries(test, type='word', skip_word_none=TRUE, skip_word_number=TRUE) [[1]] [1] "The" "above" "mentioned" "features" "are" "very" [7] "useful" "Spam" "spam" "eggs" "bacon" "and" [13] "spam" > stri_split_boundaries(test, type='sentence') [[1]] [1] "The above-mentioned features are very useful. " [2] "Spam, spam, eggs, bacon, and spam. " [3] "123 456 789" > stri_split_boundaries(test, type='sentence', skip_sentence_sep=TRUE) [[1]] [1] "The above-mentioned features are very useful. " [2] "Spam, spam, eggs, bacon, and spam. " > stri_split_boundaries(test, type='character') [[1]] [1] "T" "h" "e" " " "a" "b" "o" "v" "e" "-" "m" "e" "n" "t" "i" "o" "n" "e" "d" [20] " " " " " " " " "f" "e" "a" "t" "u" "r" "e" "s" " " "a" "r" "e" " " "v" "e" [39] "r" "y" " " "u" "s" "e" "f" "u" "l" "." " " "S" "p" "a" "m" "," " " "s" "p" [58] "a" "m" "," " " "e" "g" "g" "s" "," " " "b" "a" "c" "o" "n" "," " " "a" "n" [77] "d" " " "s" "p" "a" "m" "." " " "1" "2" "3" " " "4" "5" "6" " " "7" "8" "9" > > # a filtered break iterator with the new ICU: > stri_split_boundaries('Mr. Jones and Mrs. Brown are very happy. + So am I, Prof. Smith.', type='sentence', locale='en_US@ss=standard') # ICU >= 56 only [[1]] [1] "Mr. Jones and Mrs. Brown are very happy.\n" [2] "So am I, Prof. Smith." > > > > > cleanEx() > nameEx("stri_sprintf") > ### * stri_sprintf > > flush(stderr()); flush(stdout()) > > ### Name: stri_sprintf > ### Title: Format Strings > ### Aliases: stri_sprintf stri_string_format stri_printf > > ### ** Examples > > stri_printf("%4s=%.3f", c("e", "e\u00b2", "\u03c0", "\u03c0\u00b2"), + c(exp(1), exp(2), pi, pi^2)) e=2.718 e²=7.389 π=3.142 π²=9.870 > > x <- c( + "xxabcd", + "xx\u0105\u0106\u0107\u0108", + stri_paste( + "\u200b\u200b\u200b\u200b", + "\U0001F3F4\U000E0067\U000E0062\U000E0073\U000E0063\U000E0074\U000E007F", + "abcd" + )) > stri_printf("[%10s]", x) # minimum width = 10 [ xxabcd] [ xxąĆćĈ] [ ​​​​🏴󠁧󠁢󠁳󠁣󠁴󠁿abcd] > stri_printf("[%-10.3s]", x) # output of max width = 3, but pad to width of 10 [xxa ] [xxą ] [​​​​🏴󠁧󠁢󠁳󠁣󠁴󠁿a ] > stri_printf("[%10s]", x, use_length=TRUE) # minimum number of Unicode code points = 10 [ xxabcd] [ xxąĆćĈ] [​​​​🏴󠁧󠁢󠁳󠁣󠁴󠁿abcd] > > # vectorization wrt all arguments: > p <- runif(10) > stri_sprintf(ifelse(p > 0.5, "P(Y=1)=%1$.2f", "P(Y=0)=%2$.2f"), p, 1-p) [1] "P(Y=0)=0.73" "P(Y=0)=0.63" "P(Y=1)=0.57" "P(Y=1)=0.91" "P(Y=0)=0.80" [6] "P(Y=1)=0.90" "P(Y=1)=0.94" "P(Y=1)=0.66" "P(Y=1)=0.63" "P(Y=0)=0.94" > > # using a "preformatted" logical vector: > x <- c(TRUE, FALSE, FALSE, NA, TRUE, FALSE) > stri_sprintf("%s) %s", letters[seq_along(x)], c("\u2718", "\u2713")[x+1]) [1] "a) ✓" "b) ✘" "c) ✘" NA "e) ✓" "f) ✘" > > # custom NA/Inf/NaN strings: > stri_printf("%+10.3f", c(-Inf, -0, 0, Inf, NaN, NA_real_), + na_string="", nan_string="\U0001F4A9", inf_string="\u221E") -∞ -0.000 +0.000 +∞ 💩 > > stri_sprintf("UNIX time %1$f is %1$s.", Sys.time()) [1] "UNIX time 1784700402.081793 is 2026-07-22 07:06:42.081793." > > # the following do not work in sprintf() > stri_sprintf("%1$#- *2$.*3$f", 1.23456, 10, 3) # two asterisks [1] " 1.235 " > stri_sprintf(c("%s", "%f"), pi) # re-coercion needed [1] "3.14159265358979" "3.141593" > stri_sprintf("%1$s is %1$f UNIX time.", Sys.time()) # re-coercion needed [1] "2026-07-22 07:06:42.084979 is 1784700402.084979 UNIX time." > stri_sprintf(c("%d", "%s"), factor(11:12)) # re-coercion needed [1] "1" "12" > stri_sprintf(c("%s", "%d"), factor(11:12)) # re-coercion needed [1] "11" "2" > > > > > cleanEx() > nameEx("stri_startsendswith") > ### * stri_startsendswith > > flush(stderr()); flush(stdout()) > > ### Name: stri_startswith > ### Title: Determine if the Start or End of a String Matches a Pattern > ### Aliases: stri_startswith stri_endswith stri_startswith_fixed > ### stri_endswith_fixed stri_startswith_charclass stri_endswith_charclass > ### stri_startswith_coll stri_endswith_coll > > ### ** Examples > > stri_startswith_charclass(' trim me! ', '\\p{WSpace}') [1] TRUE > stri_startswith_fixed(c('a1', 'a2', 'b3', 'a4', 'c5'), 'a') [1] TRUE TRUE FALSE TRUE FALSE > stri_detect_regex(c('a1', 'a2', 'b3', 'a4', 'c5'), '^a') [1] TRUE TRUE FALSE TRUE FALSE > stri_startswith_fixed('ababa', 'ba') [1] FALSE > stri_startswith_fixed('ababa', 'ba', from=2) [1] TRUE > stri_startswith_coll(c('a1', 'A2', 'b3', 'A4', 'C5'), 'a', strength=1) [1] TRUE TRUE FALSE TRUE FALSE > pat <- stri_paste('\u0635\u0644\u0649 \u0627\u0644\u0644\u0647 ', + '\u0639\u0644\u064a\u0647 \u0648\u0633\u0644\u0645XYZ') > stri_endswith_coll('\ufdfa\ufdfa\ufdfaXYZ', pat, strength=1) [1] TRUE > > > > > cleanEx() > nameEx("stri_stats_general") > ### * stri_stats_general > > flush(stderr()); flush(stdout()) > > ### Name: stri_stats_general > ### Title: General Statistics for a Character Vector > ### Aliases: stri_stats_general > > ### ** Examples > > s <- c('Lorem ipsum dolor sit amet, consectetur adipisicing elit.', + 'nibh augue, suscipit a, scelerisque sed, lacinia in, mi.', + 'Cras vel lorem. Etiam pellentesque aliquet tellus.', + '') > stri_stats_general(s) Lines LinesNEmpty Chars CharsNWhite 4 3 163 142 > > > > > cleanEx() > nameEx("stri_stats_latex") > ### * stri_stats_latex > > flush(stderr()); flush(stdout()) > > ### Name: stri_stats_latex > ### Title: Statistics for a Character Vector Containing LaTeX Commands > ### Aliases: stri_stats_latex > > ### ** Examples > > s <- c('Lorem \\textbf{ipsum} dolor sit \\textit{amet}, consectetur adipisicing elit.', + '\\begin{small}Proin nibh augue,\\end{small} suscipit a, scelerisque sed, lacinia in, mi.', + '') > stri_stats_latex(s) CharsWord CharsCmdEnvir CharsWhite Words Cmds 96 38 27 18 2 Envirs 1 > > > > > cleanEx() > nameEx("stri_sub") > ### * stri_sub > > flush(stderr()); flush(stdout()) > > ### Name: stri_sub > ### Title: Extract a Substring From or Replace a Substring In a Character > ### Vector > ### Aliases: stri_sub stri_sub<- stri_sub_replace > > ### ** Examples > > s <- c("spam, spam, bacon, and spam", "eggs and spam") > stri_sub(s, from=-4) [1] "spam" "spam" > stri_sub(s, from=1, length=c(10, 4)) [1] "spam, spam" "eggs" > (stri_sub(s, 1, 4) <- 'stringi') [1] "stringi" > > x <- c('12 3456 789', 'abc', '', NA, '667') > stri_sub(x, stri_locate_first_regex(x, '[0-9]+')) # see stri_extract_first [1] "12" NA NA NA "667" > stri_sub(x, stri_locate_last_regex(x, '[0-9]+')) # see stri_extract_last [1] "789" NA NA NA "667" > > stri_sub_replace(x, stri_locate_first_regex(x, '[0-9]+'), + omit_na=TRUE, replacement='***') # see stri_replace_first [1] "*** 3456 789" "abc" "" NA "***" > stri_sub_replace(x, stri_locate_last_regex(x, '[0-9]+'), + omit_na=TRUE, replacement='***') # see stri_replace_last [1] "12 3456 ***" "abc" "" NA "***" > > > ## Not run: x |> stri_sub_replace(1, 5, replacement='new_substring') > > > > cleanEx() > nameEx("stri_sub_all") > ### * stri_sub_all > > flush(stderr()); flush(stdout()) > > ### Name: stri_sub_all > ### Title: Extract or Replace Multiple Substrings > ### Aliases: stri_sub_all stri_sub_all<- stri_sub_replace_all > ### stri_sub_all_replace > > ### ** Examples > > x <- c('12 3456 789', 'abc', '', NA, '667') > stri_sub_all(x, stri_locate_all_regex(x, '[0-9]+')) # see stri_extract_all [[1]] [1] "12" "3456" "789" [[2]] [1] NA [[3]] [1] NA [[4]] [1] NA [[5]] [1] "667" > stri_sub_all(x, stri_locate_all_regex(x, '[0-9]+', omit_no_match=TRUE)) [[1]] [1] "12" "3456" "789" [[2]] character(0) [[3]] character(0) [[4]] [1] NA [[5]] [1] "667" > > stri_sub_all(x, stri_locate_all_regex(x, '[0-9]+', omit_no_match=TRUE)) <- '***' > print(x) [1] "*** *** ***" "abc" "" NA "***" > > stri_sub_replace_all('a b c', c(1, 3, 5), c(1, 3, 5), replacement=c('A', 'B', 'C')) [1] "A B C" > > > > > > cleanEx() > nameEx("stri_subset") > ### * stri_subset > > flush(stderr()); flush(stdout()) > > ### Name: stri_subset > ### Title: Select Elements that Match a Given Pattern > ### Aliases: stri_subset stri_subset<- stri_subset_fixed > ### stri_subset_fixed<- stri_subset_charclass stri_subset_charclass<- > ### stri_subset_coll stri_subset_coll<- stri_subset_regex > ### stri_subset_regex<- > > ### ** Examples > > stri_subset_regex(c('stringi R', '123', 'ID456', ''), '^[0-9]+$') [1] "123" > > x <- c('stringi R', '123', 'ID456', '') > `stri_subset_regex<-`(x, '[0-9]+$', negate=TRUE, value=NA) # returns a copy [1] NA "123" "ID456" NA > stri_subset_regex(x, '[0-9]+$') <- NA # modifies `x` in-place > print(x) [1] "stringi R" NA NA "" > > > > > cleanEx() > nameEx("stri_timezone_info") > ### * stri_timezone_info > > flush(stderr()); flush(stdout()) > > ### Name: stri_timezone_info > ### Title: Query a Given Time Zone > ### Aliases: stri_timezone_info > > ### ** Examples > > stri_timezone_info() $ID [1] "Europe/London" $Name [1] "Greenwich Mean Time" $Name.Daylight [1] "British Summer Time" $Name.Windows [1] "GMT Standard Time" $RawOffset [1] 0 $UsesDaylightTime [1] TRUE > stri_timezone_info(locale='sk_SK') $ID [1] "Europe/London" $Name [1] "greenwichský čas" $Name.Daylight [1] "britský letný čas" $Name.Windows [1] "GMT Standard Time" $RawOffset [1] 0 $UsesDaylightTime [1] TRUE > sapply(c('short', 'long', 'generic_short', 'generic_long', + 'gmt_short', 'gmt_long', 'common', 'generic_location'), + function(e) stri_timezone_info('Europe/London', display_type=e)) short long ID "Europe/London" "Europe/London" Name "GMT" "Greenwich Mean Time" Name.Daylight "BST" "British Summer Time" Name.Windows "GMT Standard Time" "GMT Standard Time" RawOffset 0 0 UsesDaylightTime TRUE TRUE generic_short generic_long ID "Europe/London" "Europe/London" Name "United Kingdom Time" "United Kingdom Time" Name.Daylight "United Kingdom Time" "United Kingdom Time" Name.Windows "GMT Standard Time" "GMT Standard Time" RawOffset 0 0 UsesDaylightTime TRUE TRUE gmt_short gmt_long common ID "Europe/London" "Europe/London" "Europe/London" Name "+0000" "GMT" "GMT" Name.Daylight "+0100" "GMT+01:00" "BST" Name.Windows "GMT Standard Time" "GMT Standard Time" "GMT Standard Time" RawOffset 0 0 0 UsesDaylightTime TRUE TRUE TRUE generic_location ID "Europe/London" Name "United Kingdom Time" Name.Daylight "United Kingdom Time" Name.Windows "GMT Standard Time" RawOffset 0 UsesDaylightTime TRUE > > > > > cleanEx() > nameEx("stri_timezone_list") > ### * stri_timezone_list > > flush(stderr()); flush(stdout()) > > ### Name: stri_timezone_list > ### Title: List Available Time Zone Identifiers > ### Aliases: stri_timezone_list > > ### ** Examples > > stri_timezone_list() [1] "ACT" "AET" [3] "Africa/Abidjan" "Africa/Accra" [5] "Africa/Addis_Ababa" "Africa/Algiers" [7] "Africa/Asmara" "Africa/Asmera" [9] "Africa/Bamako" "Africa/Bangui" [11] "Africa/Banjul" "Africa/Bissau" [13] "Africa/Blantyre" "Africa/Brazzaville" [15] "Africa/Bujumbura" "Africa/Cairo" [17] "Africa/Casablanca" "Africa/Ceuta" [19] "Africa/Conakry" "Africa/Dakar" [21] "Africa/Dar_es_Salaam" "Africa/Djibouti" [23] "Africa/Douala" "Africa/El_Aaiun" [25] "Africa/Freetown" "Africa/Gaborone" [27] "Africa/Harare" "Africa/Johannesburg" [29] "Africa/Juba" "Africa/Kampala" [31] "Africa/Khartoum" "Africa/Kigali" [33] "Africa/Kinshasa" "Africa/Lagos" [35] "Africa/Libreville" "Africa/Lome" [37] "Africa/Luanda" "Africa/Lubumbashi" [39] "Africa/Lusaka" "Africa/Malabo" [41] "Africa/Maputo" "Africa/Maseru" [43] "Africa/Mbabane" "Africa/Mogadishu" [45] "Africa/Monrovia" "Africa/Nairobi" [47] "Africa/Ndjamena" "Africa/Niamey" [49] "Africa/Nouakchott" "Africa/Ouagadougou" [51] "Africa/Porto-Novo" "Africa/Sao_Tome" [53] "Africa/Timbuktu" "Africa/Tripoli" [55] "Africa/Tunis" "Africa/Windhoek" [57] "AGT" "America/Adak" [59] "America/Anchorage" "America/Anguilla" [61] "America/Antigua" "America/Araguaina" [63] "America/Argentina/Buenos_Aires" "America/Argentina/Catamarca" [65] "America/Argentina/ComodRivadavia" "America/Argentina/Cordoba" [67] "America/Argentina/Jujuy" "America/Argentina/La_Rioja" [69] "America/Argentina/Mendoza" "America/Argentina/Rio_Gallegos" [71] "America/Argentina/Salta" "America/Argentina/San_Juan" [73] "America/Argentina/San_Luis" "America/Argentina/Tucuman" [75] "America/Argentina/Ushuaia" "America/Aruba" [77] "America/Asuncion" "America/Atikokan" [79] "America/Atka" "America/Bahia" [81] "America/Bahia_Banderas" "America/Barbados" [83] "America/Belem" "America/Belize" [85] "America/Blanc-Sablon" "America/Boa_Vista" [87] "America/Bogota" "America/Boise" [89] "America/Buenos_Aires" "America/Cambridge_Bay" [91] "America/Campo_Grande" "America/Cancun" [93] "America/Caracas" "America/Catamarca" [95] "America/Cayenne" "America/Cayman" [97] "America/Chicago" "America/Chihuahua" [99] "America/Ciudad_Juarez" "America/Coral_Harbour" [101] "America/Cordoba" "America/Costa_Rica" [103] "America/Creston" "America/Cuiaba" [105] "America/Curacao" "America/Danmarkshavn" [107] "America/Dawson" "America/Dawson_Creek" [109] "America/Denver" "America/Detroit" [111] "America/Dominica" "America/Edmonton" [113] "America/Eirunepe" "America/El_Salvador" [115] "America/Ensenada" "America/Fort_Nelson" [117] "America/Fort_Wayne" "America/Fortaleza" [119] "America/Glace_Bay" "America/Godthab" [121] "America/Goose_Bay" "America/Grand_Turk" [123] "America/Grenada" "America/Guadeloupe" [125] "America/Guatemala" "America/Guayaquil" [127] "America/Guyana" "America/Halifax" [129] "America/Havana" "America/Hermosillo" [131] "America/Indiana/Indianapolis" "America/Indiana/Knox" [133] "America/Indiana/Marengo" "America/Indiana/Petersburg" [135] "America/Indiana/Tell_City" "America/Indiana/Vevay" [137] "America/Indiana/Vincennes" "America/Indiana/Winamac" [139] "America/Indianapolis" "America/Inuvik" [141] "America/Iqaluit" "America/Jamaica" [143] "America/Jujuy" "America/Juneau" [145] "America/Kentucky/Louisville" "America/Kentucky/Monticello" [147] "America/Knox_IN" "America/Kralendijk" [149] "America/La_Paz" "America/Lima" [151] "America/Los_Angeles" "America/Louisville" [153] "America/Lower_Princes" "America/Maceio" [155] "America/Managua" "America/Manaus" [157] "America/Marigot" "America/Martinique" [159] "America/Matamoros" "America/Mazatlan" [161] "America/Mendoza" "America/Menominee" [163] "America/Merida" "America/Metlakatla" [165] "America/Mexico_City" "America/Miquelon" [167] "America/Moncton" "America/Monterrey" [169] "America/Montevideo" "America/Montreal" [171] "America/Montserrat" "America/Nassau" [173] "America/New_York" "America/Nipigon" [175] "America/Nome" "America/Noronha" [177] "America/North_Dakota/Beulah" "America/North_Dakota/Center" [179] "America/North_Dakota/New_Salem" "America/Nuuk" [181] "America/Ojinaga" "America/Panama" [183] "America/Pangnirtung" "America/Paramaribo" [185] "America/Phoenix" "America/Port_of_Spain" [187] "America/Port-au-Prince" "America/Porto_Acre" [189] "America/Porto_Velho" "America/Puerto_Rico" [191] "America/Punta_Arenas" "America/Rainy_River" [193] "America/Rankin_Inlet" "America/Recife" [195] "America/Regina" "America/Resolute" [197] "America/Rio_Branco" "America/Rosario" [199] "America/Santa_Isabel" "America/Santarem" [201] "America/Santiago" "America/Santo_Domingo" [203] "America/Sao_Paulo" "America/Scoresbysund" [205] "America/Shiprock" "America/Sitka" [207] "America/St_Barthelemy" "America/St_Johns" [209] "America/St_Kitts" "America/St_Lucia" [211] "America/St_Thomas" "America/St_Vincent" [213] "America/Swift_Current" "America/Tegucigalpa" [215] "America/Thule" "America/Thunder_Bay" [217] "America/Tijuana" "America/Toronto" [219] "America/Tortola" "America/Vancouver" [221] "America/Virgin" "America/Whitehorse" [223] "America/Winnipeg" "America/Yakutat" [225] "America/Yellowknife" "Antarctica/Casey" [227] "Antarctica/Davis" "Antarctica/DumontDUrville" [229] "Antarctica/Macquarie" "Antarctica/Mawson" [231] "Antarctica/McMurdo" "Antarctica/Palmer" [233] "Antarctica/Rothera" "Antarctica/South_Pole" [235] "Antarctica/Syowa" "Antarctica/Troll" [237] "Antarctica/Vostok" "Arctic/Longyearbyen" [239] "ART" "Asia/Aden" [241] "Asia/Almaty" "Asia/Amman" [243] "Asia/Anadyr" "Asia/Aqtau" [245] "Asia/Aqtobe" "Asia/Ashgabat" [247] "Asia/Ashkhabad" "Asia/Atyrau" [249] "Asia/Baghdad" "Asia/Bahrain" [251] "Asia/Baku" "Asia/Bangkok" [253] "Asia/Barnaul" "Asia/Beirut" [255] "Asia/Bishkek" "Asia/Brunei" [257] "Asia/Calcutta" "Asia/Chita" [259] "Asia/Choibalsan" "Asia/Chongqing" [261] "Asia/Chungking" "Asia/Colombo" [263] "Asia/Dacca" "Asia/Damascus" [265] "Asia/Dhaka" "Asia/Dili" [267] "Asia/Dubai" "Asia/Dushanbe" [269] "Asia/Famagusta" "Asia/Gaza" [271] "Asia/Harbin" "Asia/Hebron" [273] "Asia/Ho_Chi_Minh" "Asia/Hong_Kong" [275] "Asia/Hovd" "Asia/Irkutsk" [277] "Asia/Istanbul" "Asia/Jakarta" [279] "Asia/Jayapura" "Asia/Jerusalem" [281] "Asia/Kabul" "Asia/Kamchatka" [283] "Asia/Karachi" "Asia/Kashgar" [285] "Asia/Kathmandu" "Asia/Katmandu" [287] "Asia/Khandyga" "Asia/Kolkata" [289] "Asia/Krasnoyarsk" "Asia/Kuala_Lumpur" [291] "Asia/Kuching" "Asia/Kuwait" [293] "Asia/Macao" "Asia/Macau" [295] "Asia/Magadan" "Asia/Makassar" [297] "Asia/Manila" "Asia/Muscat" [299] "Asia/Nicosia" "Asia/Novokuznetsk" [301] "Asia/Novosibirsk" "Asia/Omsk" [303] "Asia/Oral" "Asia/Phnom_Penh" [305] "Asia/Pontianak" "Asia/Pyongyang" [307] "Asia/Qatar" "Asia/Qostanay" [309] "Asia/Qyzylorda" "Asia/Rangoon" [311] "Asia/Riyadh" "Asia/Saigon" [313] "Asia/Sakhalin" "Asia/Samarkand" [315] "Asia/Seoul" "Asia/Shanghai" [317] "Asia/Singapore" "Asia/Srednekolymsk" [319] "Asia/Taipei" "Asia/Tashkent" [321] "Asia/Tbilisi" "Asia/Tehran" [323] "Asia/Tel_Aviv" "Asia/Thimbu" [325] "Asia/Thimphu" "Asia/Tokyo" [327] "Asia/Tomsk" "Asia/Ujung_Pandang" [329] "Asia/Ulaanbaatar" "Asia/Ulan_Bator" [331] "Asia/Urumqi" "Asia/Ust-Nera" [333] "Asia/Vientiane" "Asia/Vladivostok" [335] "Asia/Yakutsk" "Asia/Yangon" [337] "Asia/Yekaterinburg" "Asia/Yerevan" [339] "AST" "Atlantic/Azores" [341] "Atlantic/Bermuda" "Atlantic/Canary" [343] "Atlantic/Cape_Verde" "Atlantic/Faeroe" [345] "Atlantic/Faroe" "Atlantic/Jan_Mayen" [347] "Atlantic/Madeira" "Atlantic/Reykjavik" [349] "Atlantic/South_Georgia" "Atlantic/St_Helena" [351] "Atlantic/Stanley" "Australia/ACT" [353] "Australia/Adelaide" "Australia/Brisbane" [355] "Australia/Broken_Hill" "Australia/Canberra" [357] "Australia/Currie" "Australia/Darwin" [359] "Australia/Eucla" "Australia/Hobart" [361] "Australia/LHI" "Australia/Lindeman" [363] "Australia/Lord_Howe" "Australia/Melbourne" [365] "Australia/North" "Australia/NSW" [367] "Australia/Perth" "Australia/Queensland" [369] "Australia/South" "Australia/Sydney" [371] "Australia/Tasmania" "Australia/Victoria" [373] "Australia/West" "Australia/Yancowinna" [375] "BET" "Brazil/Acre" [377] "Brazil/DeNoronha" "Brazil/East" [379] "Brazil/West" "BST" [381] "Canada/Atlantic" "Canada/Central" [383] "Canada/East-Saskatchewan" "Canada/Eastern" [385] "Canada/Mountain" "Canada/Newfoundland" [387] "Canada/Pacific" "Canada/Saskatchewan" [389] "Canada/Yukon" "CAT" [391] "CET" "Chile/Continental" [393] "Chile/EasterIsland" "CNT" [395] "CST" "CST6CDT" [397] "CTT" "Cuba" [399] "EAT" "ECT" [401] "EET" "Egypt" [403] "Eire" "EST" [405] "EST5EDT" "Etc/GMT" [407] "Etc/GMT-0" "Etc/GMT-1" [409] "Etc/GMT-2" "Etc/GMT-3" [411] "Etc/GMT-4" "Etc/GMT-5" [413] "Etc/GMT-6" "Etc/GMT-7" [415] "Etc/GMT-8" "Etc/GMT-9" [417] "Etc/GMT-10" "Etc/GMT-11" [419] "Etc/GMT-12" "Etc/GMT-13" [421] "Etc/GMT-14" "Etc/GMT+0" [423] "Etc/GMT+1" "Etc/GMT+2" [425] "Etc/GMT+3" "Etc/GMT+4" [427] "Etc/GMT+5" "Etc/GMT+6" [429] "Etc/GMT+7" "Etc/GMT+8" [431] "Etc/GMT+9" "Etc/GMT+10" [433] "Etc/GMT+11" "Etc/GMT+12" [435] "Etc/GMT0" "Etc/Greenwich" [437] "Etc/UCT" "Etc/Universal" [439] "Etc/UTC" "Etc/Zulu" [441] "Europe/Amsterdam" "Europe/Andorra" [443] "Europe/Astrakhan" "Europe/Athens" [445] "Europe/Belfast" "Europe/Belgrade" [447] "Europe/Berlin" "Europe/Bratislava" [449] "Europe/Brussels" "Europe/Bucharest" [451] "Europe/Budapest" "Europe/Busingen" [453] "Europe/Chisinau" "Europe/Copenhagen" [455] "Europe/Dublin" "Europe/Gibraltar" [457] "Europe/Guernsey" "Europe/Helsinki" [459] "Europe/Isle_of_Man" "Europe/Istanbul" [461] "Europe/Jersey" "Europe/Kaliningrad" [463] "Europe/Kiev" "Europe/Kirov" [465] "Europe/Kyiv" "Europe/Lisbon" [467] "Europe/Ljubljana" "Europe/London" [469] "Europe/Luxembourg" "Europe/Madrid" [471] "Europe/Malta" "Europe/Mariehamn" [473] "Europe/Minsk" "Europe/Monaco" [475] "Europe/Moscow" "Europe/Nicosia" [477] "Europe/Oslo" "Europe/Paris" [479] "Europe/Podgorica" "Europe/Prague" [481] "Europe/Riga" "Europe/Rome" [483] "Europe/Samara" "Europe/San_Marino" [485] "Europe/Sarajevo" "Europe/Saratov" [487] "Europe/Simferopol" "Europe/Skopje" [489] "Europe/Sofia" "Europe/Stockholm" [491] "Europe/Tallinn" "Europe/Tirane" [493] "Europe/Tiraspol" "Europe/Ulyanovsk" [495] "Europe/Uzhgorod" "Europe/Vaduz" [497] "Europe/Vatican" "Europe/Vienna" [499] "Europe/Vilnius" "Europe/Volgograd" [501] "Europe/Warsaw" "Europe/Zagreb" [503] "Europe/Zaporozhye" "Europe/Zurich" [505] "Factory" "GB" [507] "GB-Eire" "GMT" [509] "GMT-0" "GMT+0" [511] "GMT0" "Greenwich" [513] "Hongkong" "HST" [515] "Iceland" "IET" [517] "Indian/Antananarivo" "Indian/Chagos" [519] "Indian/Christmas" "Indian/Cocos" [521] "Indian/Comoro" "Indian/Kerguelen" [523] "Indian/Mahe" "Indian/Maldives" [525] "Indian/Mauritius" "Indian/Mayotte" [527] "Indian/Reunion" "Iran" [529] "Israel" "IST" [531] "Jamaica" "Japan" [533] "JST" "Kwajalein" [535] "Libya" "MET" [537] "Mexico/BajaNorte" "Mexico/BajaSur" [539] "Mexico/General" "MIT" [541] "MST" "MST7MDT" [543] "Navajo" "NET" [545] "NST" "NZ" [547] "NZ-CHAT" "Pacific/Apia" [549] "Pacific/Auckland" "Pacific/Bougainville" [551] "Pacific/Chatham" "Pacific/Chuuk" [553] "Pacific/Easter" "Pacific/Efate" [555] "Pacific/Enderbury" "Pacific/Fakaofo" [557] "Pacific/Fiji" "Pacific/Funafuti" [559] "Pacific/Galapagos" "Pacific/Gambier" [561] "Pacific/Guadalcanal" "Pacific/Guam" [563] "Pacific/Honolulu" "Pacific/Johnston" [565] "Pacific/Kanton" "Pacific/Kiritimati" [567] "Pacific/Kosrae" "Pacific/Kwajalein" [569] "Pacific/Majuro" "Pacific/Marquesas" [571] "Pacific/Midway" "Pacific/Nauru" [573] "Pacific/Niue" "Pacific/Norfolk" [575] "Pacific/Noumea" "Pacific/Pago_Pago" [577] "Pacific/Palau" "Pacific/Pitcairn" [579] "Pacific/Pohnpei" "Pacific/Ponape" [581] "Pacific/Port_Moresby" "Pacific/Rarotonga" [583] "Pacific/Saipan" "Pacific/Samoa" [585] "Pacific/Tahiti" "Pacific/Tarawa" [587] "Pacific/Tongatapu" "Pacific/Truk" [589] "Pacific/Wake" "Pacific/Wallis" [591] "Pacific/Yap" "PLT" [593] "PNT" "Poland" [595] "Portugal" "PRC" [597] "PRT" "PST" [599] "PST8PDT" "ROC" [601] "ROK" "Singapore" [603] "SST" "SystemV/AST4" [605] "SystemV/AST4ADT" "SystemV/CST6" [607] "SystemV/CST6CDT" "SystemV/EST5" [609] "SystemV/EST5EDT" "SystemV/HST10" [611] "SystemV/MST7" "SystemV/MST7MDT" [613] "SystemV/PST8" "SystemV/PST8PDT" [615] "SystemV/YST9" "SystemV/YST9YDT" [617] "Turkey" "UCT" [619] "Universal" "US/Alaska" [621] "US/Aleutian" "US/Arizona" [623] "US/Central" "US/East-Indiana" [625] "US/Eastern" "US/Hawaii" [627] "US/Indiana-Starke" "US/Michigan" [629] "US/Mountain" "US/Pacific" [631] "US/Pacific-New" "US/Samoa" [633] "UTC" "VST" [635] "W-SU" "WET" [637] "Zulu" > stri_timezone_list(offset=1) [1] "Africa/Algiers" "Africa/Bangui" "Africa/Brazzaville" [4] "Africa/Ceuta" "Africa/Douala" "Africa/Kinshasa" [7] "Africa/Lagos" "Africa/Libreville" "Africa/Luanda" [10] "Africa/Malabo" "Africa/Ndjamena" "Africa/Niamey" [13] "Africa/Porto-Novo" "Africa/Tunis" "Arctic/Longyearbyen" [16] "Atlantic/Jan_Mayen" "CET" "ECT" [19] "Etc/GMT-1" "Europe/Amsterdam" "Europe/Andorra" [22] "Europe/Belgrade" "Europe/Berlin" "Europe/Bratislava" [25] "Europe/Brussels" "Europe/Budapest" "Europe/Busingen" [28] "Europe/Copenhagen" "Europe/Gibraltar" "Europe/Ljubljana" [31] "Europe/Luxembourg" "Europe/Madrid" "Europe/Malta" [34] "Europe/Monaco" "Europe/Oslo" "Europe/Paris" [37] "Europe/Podgorica" "Europe/Prague" "Europe/Rome" [40] "Europe/San_Marino" "Europe/Sarajevo" "Europe/Skopje" [43] "Europe/Stockholm" "Europe/Tirane" "Europe/Vaduz" [46] "Europe/Vatican" "Europe/Vienna" "Europe/Warsaw" [49] "Europe/Zagreb" "Europe/Zurich" "MET" [52] "Poland" > stri_timezone_list(offset=5.5) [1] "Asia/Calcutta" "Asia/Colombo" "Asia/Kolkata" "IST" > stri_timezone_list(offset=5.75) [1] "Asia/Kathmandu" "Asia/Katmandu" > stri_timezone_list(region='PL') [1] "Europe/Warsaw" "Poland" > stri_timezone_list(region='US', offset=-10) [1] "America/Adak" "America/Atka" "Pacific/Honolulu" "US/Aleutian" [5] "US/Hawaii" > > # Fetch information on all time zones > do.call(rbind.data.frame, + lapply(stri_timezone_list(), function(tz) stri_timezone_info(tz))) ID Name 1 ACT Australian Central Standard Time 2 AET Australian Eastern Standard Time 3 Africa/Abidjan Greenwich Mean Time 4 Africa/Accra Greenwich Mean Time 5 Africa/Addis_Ababa East Africa Time 6 Africa/Algiers Central European Standard Time 7 Africa/Asmara East Africa Time 8 Africa/Asmera East Africa Time 9 Africa/Bamako Greenwich Mean Time 10 Africa/Bangui West Africa Standard Time 11 Africa/Banjul Greenwich Mean Time 12 Africa/Bissau Greenwich Mean Time 13 Africa/Blantyre Central Africa Time 14 Africa/Brazzaville West Africa Standard Time 15 Africa/Bujumbura Central Africa Time 16 Africa/Cairo Eastern European Standard Time 17 Africa/Casablanca GMT 18 Africa/Ceuta Central European Standard Time 19 Africa/Conakry Greenwich Mean Time 20 Africa/Dakar Greenwich Mean Time 21 Africa/Dar_es_Salaam East Africa Time 22 Africa/Djibouti East Africa Time 23 Africa/Douala West Africa Standard Time 24 Africa/El_Aaiun GMT 25 Africa/Freetown Greenwich Mean Time 26 Africa/Gaborone Central Africa Time 27 Africa/Harare Central Africa Time 28 Africa/Johannesburg South Africa Standard Time 29 Africa/Juba Central Africa Time 30 Africa/Kampala East Africa Time 31 Africa/Khartoum Central Africa Time 32 Africa/Kigali Central Africa Time 33 Africa/Kinshasa West Africa Standard Time 34 Africa/Lagos West Africa Standard Time 35 Africa/Libreville West Africa Standard Time 36 Africa/Lome Greenwich Mean Time 37 Africa/Luanda West Africa Standard Time 38 Africa/Lubumbashi Central Africa Time 39 Africa/Lusaka Central Africa Time 40 Africa/Malabo West Africa Standard Time 41 Africa/Maputo Central Africa Time 42 Africa/Maseru South Africa Standard Time 43 Africa/Mbabane South Africa Standard Time 44 Africa/Mogadishu East Africa Time 45 Africa/Monrovia Greenwich Mean Time 46 Africa/Nairobi East Africa Time 47 Africa/Ndjamena West Africa Standard Time 48 Africa/Niamey West Africa Standard Time 49 Africa/Nouakchott Greenwich Mean Time 50 Africa/Ouagadougou Greenwich Mean Time 51 Africa/Porto-Novo West Africa Standard Time 52 Africa/Sao_Tome Greenwich Mean Time 53 Africa/Timbuktu Greenwich Mean Time 54 Africa/Tripoli Eastern European Standard Time 55 Africa/Tunis Central European Standard Time 56 Africa/Windhoek Central Africa Time 57 AGT Argentina Standard Time 58 America/Adak Hawaii-Aleutian Standard Time 59 America/Anchorage Alaska Standard Time 60 America/Anguilla Atlantic Standard Time 61 America/Antigua Atlantic Standard Time 62 America/Araguaina Brasilia Standard Time 63 America/Argentina/Buenos_Aires Argentina Standard Time 64 America/Argentina/Catamarca Argentina Standard Time 65 America/Argentina/ComodRivadavia Argentina Standard Time 66 America/Argentina/Cordoba Argentina Standard Time 67 America/Argentina/Jujuy Argentina Standard Time 68 America/Argentina/La_Rioja Argentina Standard Time 69 America/Argentina/Mendoza Argentina Standard Time 70 America/Argentina/Rio_Gallegos Argentina Standard Time 71 America/Argentina/Salta Argentina Standard Time 72 America/Argentina/San_Juan Argentina Standard Time 73 America/Argentina/San_Luis Argentina Standard Time 74 America/Argentina/Tucuman Argentina Standard Time 75 America/Argentina/Ushuaia Argentina Standard Time 76 America/Aruba Atlantic Standard Time 77 America/Asuncion Paraguay Standard Time 78 America/Atikokan Eastern Standard Time 79 America/Atka Hawaii-Aleutian Standard Time 80 America/Bahia Brasilia Standard Time 81 America/Bahia_Banderas Central Standard Time 82 America/Barbados Atlantic Standard Time 83 America/Belem Brasilia Standard Time 84 America/Belize Central Standard Time 85 America/Blanc-Sablon Atlantic Standard Time 86 America/Boa_Vista Amazon Standard Time 87 America/Bogota Colombia Standard Time 88 America/Boise Mountain Standard Time 89 America/Buenos_Aires Argentina Standard Time 90 America/Cambridge_Bay Mountain Standard Time 91 America/Campo_Grande Amazon Standard Time 92 America/Cancun Eastern Standard Time 93 America/Caracas Venezuela Time 94 America/Catamarca Argentina Standard Time 95 America/Cayenne French Guiana Time 96 America/Cayman Eastern Standard Time 97 America/Chicago Central Standard Time 98 America/Chihuahua Central Standard Time 99 America/Ciudad_Juarez Mountain Standard Time 100 America/Coral_Harbour Eastern Standard Time 101 America/Cordoba Argentina Standard Time 102 America/Costa_Rica Central Standard Time 103 America/Creston Mountain Standard Time 104 America/Cuiaba Amazon Standard Time 105 America/Curacao Atlantic Standard Time 106 America/Danmarkshavn Greenwich Mean Time 107 America/Dawson Yukon Time 108 America/Dawson_Creek Mountain Standard Time 109 America/Denver Mountain Standard Time 110 America/Detroit Eastern Standard Time 111 America/Dominica Atlantic Standard Time 112 America/Edmonton Mountain Standard Time 113 America/Eirunepe Acre Standard Time 114 America/El_Salvador Central Standard Time 115 America/Ensenada Pacific Standard Time 116 America/Fort_Nelson Mountain Standard Time 117 America/Fort_Wayne Eastern Standard Time 118 America/Fortaleza Brasilia Standard Time 119 America/Glace_Bay Atlantic Standard Time 120 America/Godthab West Greenland Standard Time 121 America/Goose_Bay Atlantic Standard Time 122 America/Grand_Turk Eastern Standard Time 123 America/Grenada Atlantic Standard Time 124 America/Guadeloupe Atlantic Standard Time 125 America/Guatemala Central Standard Time 126 America/Guayaquil Ecuador Time 127 America/Guyana Guyana Time 128 America/Halifax Atlantic Standard Time 129 America/Havana Cuba Standard Time 130 America/Hermosillo Mexican Pacific Standard Time 131 America/Indiana/Indianapolis Eastern Standard Time 132 America/Indiana/Knox Central Standard Time 133 America/Indiana/Marengo Eastern Standard Time 134 America/Indiana/Petersburg Eastern Standard Time 135 America/Indiana/Tell_City Central Standard Time 136 America/Indiana/Vevay Eastern Standard Time 137 America/Indiana/Vincennes Eastern Standard Time 138 America/Indiana/Winamac Eastern Standard Time 139 America/Indianapolis Eastern Standard Time 140 America/Inuvik Mountain Standard Time 141 America/Iqaluit Eastern Standard Time 142 America/Jamaica Eastern Standard Time 143 America/Jujuy Argentina Standard Time 144 America/Juneau Alaska Standard Time 145 America/Kentucky/Louisville Eastern Standard Time 146 America/Kentucky/Monticello Eastern Standard Time 147 America/Knox_IN Central Standard Time 148 America/Kralendijk Atlantic Standard Time 149 America/La_Paz Bolivia Time 150 America/Lima Peru Standard Time 151 America/Los_Angeles Pacific Standard Time 152 America/Louisville Eastern Standard Time 153 America/Lower_Princes Atlantic Standard Time 154 America/Maceio Brasilia Standard Time 155 America/Managua Central Standard Time 156 America/Manaus Amazon Standard Time 157 America/Marigot Atlantic Standard Time 158 America/Martinique Atlantic Standard Time 159 America/Matamoros Central Standard Time 160 America/Mazatlan Mexican Pacific Standard Time 161 America/Mendoza Argentina Standard Time 162 America/Menominee Central Standard Time 163 America/Merida Central Standard Time 164 America/Metlakatla Alaska Standard Time 165 America/Mexico_City Central Standard Time 166 America/Miquelon St Pierre & Miquelon Standard Time 167 America/Moncton Atlantic Standard Time 168 America/Monterrey Central Standard Time 169 America/Montevideo Uruguay Standard Time 170 America/Montreal Eastern Standard Time 171 America/Montserrat Atlantic Standard Time 172 America/Nassau Eastern Standard Time 173 America/New_York Eastern Standard Time 174 America/Nipigon Eastern Standard Time 175 America/Nome Alaska Standard Time 176 America/Noronha Fernando de Noronha Standard Time 177 America/North_Dakota/Beulah Central Standard Time 178 America/North_Dakota/Center Central Standard Time 179 America/North_Dakota/New_Salem Central Standard Time 180 America/Nuuk West Greenland Standard Time 181 America/Ojinaga Central Standard Time 182 America/Panama Eastern Standard Time 183 America/Pangnirtung Eastern Standard Time 184 America/Paramaribo Suriname Time 185 America/Phoenix Mountain Standard Time 186 America/Port_of_Spain Atlantic Standard Time 187 America/Port-au-Prince Eastern Standard Time 188 America/Porto_Acre Acre Standard Time 189 America/Porto_Velho Amazon Standard Time 190 America/Puerto_Rico Atlantic Standard Time 191 America/Punta_Arenas GMT-03:00 192 America/Rainy_River Central Standard Time 193 America/Rankin_Inlet Central Standard Time 194 America/Recife Brasilia Standard Time 195 America/Regina Central Standard Time 196 America/Resolute Central Standard Time 197 America/Rio_Branco Acre Standard Time 198 America/Rosario Argentina Standard Time 199 America/Santa_Isabel Pacific Standard Time 200 America/Santarem Brasilia Standard Time 201 America/Santiago Chile Standard Time 202 America/Santo_Domingo Atlantic Standard Time 203 America/Sao_Paulo Brasilia Standard Time 204 America/Scoresbysund East Greenland Standard Time 205 America/Shiprock Mountain Standard Time 206 America/Sitka Alaska Standard Time 207 America/St_Barthelemy Atlantic Standard Time 208 America/St_Johns Newfoundland Standard Time 209 America/St_Kitts Atlantic Standard Time 210 America/St_Lucia Atlantic Standard Time 211 America/St_Thomas Atlantic Standard Time 212 America/St_Vincent Atlantic Standard Time 213 America/Swift_Current Central Standard Time 214 America/Tegucigalpa Central Standard Time 215 America/Thule Atlantic Standard Time 216 America/Thunder_Bay Eastern Standard Time 217 America/Tijuana Pacific Standard Time 218 America/Toronto Eastern Standard Time 219 America/Tortola Atlantic Standard Time 220 America/Vancouver Pacific Standard Time 221 America/Virgin Atlantic Standard Time 222 America/Whitehorse Yukon Time 223 America/Winnipeg Central Standard Time 224 America/Yakutat Alaska Standard Time 225 America/Yellowknife Mountain Standard Time 226 Antarctica/Casey Casey Time 227 Antarctica/Davis Davis Time 228 Antarctica/DumontDUrville Dumont-d’Urville Time 229 Antarctica/Macquarie Australian Eastern Standard Time 230 Antarctica/Mawson Mawson Time 231 Antarctica/McMurdo New Zealand Standard Time 232 Antarctica/Palmer GMT-03:00 233 Antarctica/Rothera Rothera Time 234 Antarctica/South_Pole New Zealand Standard Time 235 Antarctica/Syowa Syowa Time 236 Antarctica/Troll Greenwich Mean Time 237 Antarctica/Vostok Vostok Time 238 Arctic/Longyearbyen Central European Standard Time 239 ART Eastern European Standard Time 240 Asia/Aden Arabian Standard Time 241 Asia/Almaty East Kazakhstan Time 242 Asia/Amman GMT+03:00 243 Asia/Anadyr Anadyr Standard Time 244 Asia/Aqtau West Kazakhstan Time 245 Asia/Aqtobe West Kazakhstan Time 246 Asia/Ashgabat Turkmenistan Standard Time 247 Asia/Ashkhabad Turkmenistan Standard Time 248 Asia/Atyrau West Kazakhstan Time 249 Asia/Baghdad Arabian Standard Time 250 Asia/Bahrain Arabian Standard Time 251 Asia/Baku Azerbaijan Standard Time 252 Asia/Bangkok Indochina Time 253 Asia/Barnaul GMT+07:00 254 Asia/Beirut Eastern European Standard Time 255 Asia/Bishkek Kyrgyzstan Time 256 Asia/Brunei Brunei Darussalam Time 257 Asia/Calcutta India Standard Time 258 Asia/Chita Yakutsk Standard Time 259 Asia/Choibalsan Ulaanbaatar Standard Time 260 Asia/Chongqing China Standard Time 261 Asia/Chungking China Standard Time 262 Asia/Colombo India Standard Time 263 Asia/Dacca Bangladesh Standard Time 264 Asia/Damascus GMT+03:00 265 Asia/Dhaka Bangladesh Standard Time 266 Asia/Dili East Timor Time 267 Asia/Dubai Gulf Standard Time 268 Asia/Dushanbe Tajikistan Time 269 Asia/Famagusta GMT+02:00 270 Asia/Gaza Eastern European Standard Time 271 Asia/Harbin China Standard Time 272 Asia/Hebron Eastern European Standard Time 273 Asia/Ho_Chi_Minh Indochina Time 274 Asia/Hong_Kong Hong Kong Standard Time 275 Asia/Hovd Hovd Standard Time 276 Asia/Irkutsk Irkutsk Standard Time 277 Asia/Istanbul GMT+03:00 278 Asia/Jakarta Western Indonesia Time 279 Asia/Jayapura Eastern Indonesia Time 280 Asia/Jerusalem Israel Standard Time 281 Asia/Kabul Afghanistan Time 282 Asia/Kamchatka Petropavlovsk-Kamchatski Standard Time 283 Asia/Karachi Pakistan Standard Time 284 Asia/Kashgar GMT+06:00 285 Asia/Kathmandu Nepal Time 286 Asia/Katmandu Nepal Time 287 Asia/Khandyga Yakutsk Standard Time 288 Asia/Kolkata India Standard Time 289 Asia/Krasnoyarsk Krasnoyarsk Standard Time 290 Asia/Kuala_Lumpur Malaysia Time 291 Asia/Kuching Malaysia Time 292 Asia/Kuwait Arabian Standard Time 293 Asia/Macao China Standard Time 294 Asia/Macau China Standard Time 295 Asia/Magadan Magadan Standard Time 296 Asia/Makassar Central Indonesia Time 297 Asia/Manila Philippine Standard Time 298 Asia/Muscat Gulf Standard Time 299 Asia/Nicosia Eastern European Standard Time 300 Asia/Novokuznetsk Krasnoyarsk Standard Time 301 Asia/Novosibirsk Novosibirsk Standard Time 302 Asia/Omsk Omsk Standard Time 303 Asia/Oral West Kazakhstan Time 304 Asia/Phnom_Penh Indochina Time 305 Asia/Pontianak Western Indonesia Time 306 Asia/Pyongyang Korean Standard Time 307 Asia/Qatar Arabian Standard Time 308 Asia/Qostanay East Kazakhstan Time 309 Asia/Qyzylorda West Kazakhstan Time 310 Asia/Rangoon Myanmar Time 311 Asia/Riyadh Arabian Standard Time 312 Asia/Saigon Indochina Time 313 Asia/Sakhalin Sakhalin Standard Time 314 Asia/Samarkand Uzbekistan Standard Time 315 Asia/Seoul Korean Standard Time 316 Asia/Shanghai China Standard Time 317 Asia/Singapore Singapore Standard Time 318 Asia/Srednekolymsk GMT+11:00 319 Asia/Taipei Taipei Standard Time 320 Asia/Tashkent Uzbekistan Standard Time 321 Asia/Tbilisi Georgia Standard Time 322 Asia/Tehran Iran Standard Time 323 Asia/Tel_Aviv Israel Standard Time 324 Asia/Thimbu Bhutan Time 325 Asia/Thimphu Bhutan Time 326 Asia/Tokyo Japan Standard Time 327 Asia/Tomsk GMT+07:00 328 Asia/Ujung_Pandang Central Indonesia Time 329 Asia/Ulaanbaatar Ulaanbaatar Standard Time 330 Asia/Ulan_Bator Ulaanbaatar Standard Time 331 Asia/Urumqi GMT+06:00 332 Asia/Ust-Nera Vladivostok Standard Time 333 Asia/Vientiane Indochina Time 334 Asia/Vladivostok Vladivostok Standard Time 335 Asia/Yakutsk Yakutsk Standard Time 336 Asia/Yangon Myanmar Time 337 Asia/Yekaterinburg Yekaterinburg Standard Time 338 Asia/Yerevan Armenia Standard Time 339 AST Alaska Standard Time 340 Atlantic/Azores Azores Standard Time 341 Atlantic/Bermuda Atlantic Standard Time 342 Atlantic/Canary Western European Standard Time 343 Atlantic/Cape_Verde Cape Verde Standard Time 344 Atlantic/Faeroe Western European Standard Time 345 Atlantic/Faroe Western European Standard Time 346 Atlantic/Jan_Mayen Central European Standard Time 347 Atlantic/Madeira Western European Standard Time 348 Atlantic/Reykjavik Greenwich Mean Time 349 Atlantic/South_Georgia South Georgia Time 350 Atlantic/St_Helena Greenwich Mean Time 351 Atlantic/Stanley Falkland Islands Standard Time 352 Australia/ACT Australian Eastern Standard Time 353 Australia/Adelaide Australian Central Standard Time 354 Australia/Brisbane Australian Eastern Standard Time 355 Australia/Broken_Hill Australian Central Standard Time 356 Australia/Canberra Australian Eastern Standard Time 357 Australia/Currie Australian Eastern Standard Time 358 Australia/Darwin Australian Central Standard Time 359 Australia/Eucla Australian Central Western Standard Time 360 Australia/Hobart Australian Eastern Standard Time 361 Australia/LHI Lord Howe Standard Time 362 Australia/Lindeman Australian Eastern Standard Time 363 Australia/Lord_Howe Lord Howe Standard Time 364 Australia/Melbourne Australian Eastern Standard Time 365 Australia/North Australian Central Standard Time 366 Australia/NSW Australian Eastern Standard Time 367 Australia/Perth Australian Western Standard Time 368 Australia/Queensland Australian Eastern Standard Time 369 Australia/South Australian Central Standard Time 370 Australia/Sydney Australian Eastern Standard Time 371 Australia/Tasmania Australian Eastern Standard Time 372 Australia/Victoria Australian Eastern Standard Time 373 Australia/West Australian Western Standard Time 374 Australia/Yancowinna Australian Central Standard Time 375 BET Brasilia Standard Time 376 Brazil/Acre Acre Standard Time 377 Brazil/DeNoronha Fernando de Noronha Standard Time 378 Brazil/East Brasilia Standard Time 379 Brazil/West Amazon Standard Time 380 BST Bangladesh Standard Time 381 Canada/Atlantic Atlantic Standard Time 382 Canada/Central Central Standard Time 383 Canada/East-Saskatchewan Central Standard Time 384 Canada/Eastern Eastern Standard Time 385 Canada/Mountain Mountain Standard Time 386 Canada/Newfoundland Newfoundland Standard Time 387 Canada/Pacific Pacific Standard Time 388 Canada/Saskatchewan Central Standard Time 389 Canada/Yukon Yukon Time 390 CAT Central Africa Time 391 CET GMT+01:00 392 Chile/Continental Chile Standard Time 393 Chile/EasterIsland Easter Island Standard Time 394 CNT Newfoundland Standard Time 395 CST Central Standard Time 396 CST6CDT Central Standard Time 397 CTT China Standard Time 398 Cuba Cuba Standard Time 399 EAT East Africa Time 400 ECT Central European Standard Time 401 EET GMT+02:00 402 Egypt Eastern European Standard Time 403 Eire Greenwich Mean Time 404 EST GMT-05:00 405 EST5EDT Eastern Standard Time 406 Etc/GMT Greenwich Mean Time 407 Etc/GMT-0 Greenwich Mean Time 408 Etc/GMT-1 GMT+01:00 409 Etc/GMT-2 GMT+02:00 410 Etc/GMT-3 GMT+03:00 411 Etc/GMT-4 GMT+04:00 412 Etc/GMT-5 GMT+05:00 413 Etc/GMT-6 GMT+06:00 414 Etc/GMT-7 GMT+07:00 415 Etc/GMT-8 GMT+08:00 416 Etc/GMT-9 GMT+09:00 417 Etc/GMT-10 GMT+10:00 418 Etc/GMT-11 GMT+11:00 419 Etc/GMT-12 GMT+12:00 420 Etc/GMT-13 GMT+13:00 421 Etc/GMT-14 GMT+14:00 422 Etc/GMT+0 Greenwich Mean Time 423 Etc/GMT+1 GMT-01:00 424 Etc/GMT+2 GMT-02:00 425 Etc/GMT+3 GMT-03:00 426 Etc/GMT+4 GMT-04:00 427 Etc/GMT+5 GMT-05:00 428 Etc/GMT+6 GMT-06:00 429 Etc/GMT+7 GMT-07:00 430 Etc/GMT+8 GMT-08:00 431 Etc/GMT+9 GMT-09:00 432 Etc/GMT+10 GMT-10:00 433 Etc/GMT+11 GMT-11:00 434 Etc/GMT+12 GMT-12:00 435 Etc/GMT0 Greenwich Mean Time 436 Etc/Greenwich Greenwich Mean Time 437 Etc/UCT Coordinated Universal Time 438 Etc/Universal Coordinated Universal Time 439 Etc/UTC Coordinated Universal Time 440 Etc/Zulu Coordinated Universal Time 441 Europe/Amsterdam Central European Standard Time 442 Europe/Andorra Central European Standard Time 443 Europe/Astrakhan GMT+04:00 444 Europe/Athens Eastern European Standard Time 445 Europe/Belfast Greenwich Mean Time 446 Europe/Belgrade Central European Standard Time 447 Europe/Berlin Central European Standard Time 448 Europe/Bratislava Central European Standard Time 449 Europe/Brussels Central European Standard Time 450 Europe/Bucharest Eastern European Standard Time 451 Europe/Budapest Central European Standard Time 452 Europe/Busingen Central European Standard Time 453 Europe/Chisinau Eastern European Standard Time 454 Europe/Copenhagen Central European Standard Time 455 Europe/Dublin Greenwich Mean Time 456 Europe/Gibraltar Central European Standard Time 457 Europe/Guernsey Greenwich Mean Time 458 Europe/Helsinki Eastern European Standard Time 459 Europe/Isle_of_Man Greenwich Mean Time 460 Europe/Istanbul GMT+03:00 461 Europe/Jersey Greenwich Mean Time 462 Europe/Kaliningrad Eastern European Standard Time 463 Europe/Kiev Eastern European Standard Time 464 Europe/Kirov GMT+03:00 465 Europe/Kyiv Eastern European Standard Time 466 Europe/Lisbon Western European Standard Time 467 Europe/Ljubljana Central European Standard Time 468 Europe/London Greenwich Mean Time 469 Europe/Luxembourg Central European Standard Time 470 Europe/Madrid Central European Standard Time 471 Europe/Malta Central European Standard Time 472 Europe/Mariehamn Eastern European Standard Time 473 Europe/Minsk Moscow Standard Time 474 Europe/Monaco Central European Standard Time 475 Europe/Moscow Moscow Standard Time 476 Europe/Nicosia Eastern European Standard Time 477 Europe/Oslo Central European Standard Time 478 Europe/Paris Central European Standard Time 479 Europe/Podgorica Central European Standard Time 480 Europe/Prague Central European Standard Time 481 Europe/Riga Eastern European Standard Time 482 Europe/Rome Central European Standard Time 483 Europe/Samara Samara Standard Time 484 Europe/San_Marino Central European Standard Time 485 Europe/Sarajevo Central European Standard Time 486 Europe/Saratov GMT+04:00 487 Europe/Simferopol Moscow Standard Time 488 Europe/Skopje Central European Standard Time 489 Europe/Sofia Eastern European Standard Time 490 Europe/Stockholm Central European Standard Time 491 Europe/Tallinn Eastern European Standard Time 492 Europe/Tirane Central European Standard Time 493 Europe/Tiraspol Eastern European Standard Time 494 Europe/Ulyanovsk GMT+04:00 495 Europe/Uzhgorod Eastern European Standard Time 496 Europe/Vaduz Central European Standard Time 497 Europe/Vatican Central European Standard Time 498 Europe/Vienna Central European Standard Time 499 Europe/Vilnius Eastern European Standard Time 500 Europe/Volgograd Volgograd Standard Time 501 Europe/Warsaw Central European Standard Time 502 Europe/Zagreb Central European Standard Time 503 Europe/Zaporozhye Eastern European Standard Time 504 Europe/Zurich Central European Standard Time 505 Factory GMT 506 GB Greenwich Mean Time 507 GB-Eire Greenwich Mean Time 508 GMT Greenwich Mean Time 509 GMT-0 Greenwich Mean Time 510 GMT+0 Greenwich Mean Time 511 GMT0 Greenwich Mean Time 512 Greenwich Greenwich Mean Time 513 Hongkong Hong Kong Standard Time 514 HST GMT-10:00 515 Iceland Greenwich Mean Time 516 IET Eastern Standard Time 517 Indian/Antananarivo East Africa Time 518 Indian/Chagos Indian Ocean Time 519 Indian/Christmas Christmas Island Time 520 Indian/Cocos Cocos Islands Time 521 Indian/Comoro East Africa Time 522 Indian/Kerguelen French Southern & Antarctic Time 523 Indian/Mahe Seychelles Time 524 Indian/Maldives Maldives Time 525 Indian/Mauritius Mauritius Standard Time 526 Indian/Mayotte East Africa Time 527 Indian/Reunion Réunion Time 528 Iran Iran Standard Time 529 Israel Israel Standard Time 530 IST India Standard Time 531 Jamaica Eastern Standard Time 532 Japan Japan Standard Time 533 JST Japan Standard Time 534 Kwajalein Marshall Islands Time 535 Libya Eastern European Standard Time 536 MET GMT+01:00 537 Mexico/BajaNorte Pacific Standard Time 538 Mexico/BajaSur Mexican Pacific Standard Time 539 Mexico/General Central Standard Time 540 MIT Apia Standard Time 541 MST GMT-07:00 542 MST7MDT Mountain Standard Time 543 Navajo Mountain Standard Time 544 NET Armenia Standard Time 545 NST New Zealand Standard Time 546 NZ New Zealand Standard Time 547 NZ-CHAT Chatham Standard Time 548 Pacific/Apia Apia Standard Time 549 Pacific/Auckland New Zealand Standard Time 550 Pacific/Bougainville GMT+11:00 551 Pacific/Chatham Chatham Standard Time 552 Pacific/Chuuk Chuuk Time 553 Pacific/Easter Easter Island Standard Time 554 Pacific/Efate Vanuatu Standard Time 555 Pacific/Enderbury Phoenix Islands Time 556 Pacific/Fakaofo Tokelau Time 557 Pacific/Fiji Fiji Standard Time 558 Pacific/Funafuti Tuvalu Time 559 Pacific/Galapagos Galapagos Time 560 Pacific/Gambier Gambier Time 561 Pacific/Guadalcanal Solomon Islands Time 562 Pacific/Guam Chamorro Standard Time 563 Pacific/Honolulu Hawaii-Aleutian Standard Time 564 Pacific/Johnston Hawaii-Aleutian Standard Time 565 Pacific/Kanton Phoenix Islands Time 566 Pacific/Kiritimati Line Islands Time 567 Pacific/Kosrae Kosrae Time 568 Pacific/Kwajalein Marshall Islands Time 569 Pacific/Majuro Marshall Islands Time 570 Pacific/Marquesas Marquesas Time 571 Pacific/Midway Samoa Standard Time 572 Pacific/Nauru Nauru Time 573 Pacific/Niue Niue Time 574 Pacific/Norfolk Norfolk Island Standard Time 575 Pacific/Noumea New Caledonia Standard Time 576 Pacific/Pago_Pago Samoa Standard Time 577 Pacific/Palau Palau Time 578 Pacific/Pitcairn Pitcairn Time 579 Pacific/Pohnpei Ponape Time 580 Pacific/Ponape Ponape Time 581 Pacific/Port_Moresby Papua New Guinea Time 582 Pacific/Rarotonga Cook Islands Standard Time 583 Pacific/Saipan Chamorro Standard Time 584 Pacific/Samoa Samoa Standard Time 585 Pacific/Tahiti Tahiti Time 586 Pacific/Tarawa Gilbert Islands Time 587 Pacific/Tongatapu Tonga Standard Time 588 Pacific/Truk Chuuk Time 589 Pacific/Wake Wake Island Time 590 Pacific/Wallis Wallis & Futuna Time 591 Pacific/Yap Chuuk Time 592 PLT Pakistan Standard Time 593 PNT Mountain Standard Time 594 Poland Central European Standard Time 595 Portugal Western European Standard Time 596 PRC China Standard Time 597 PRT Atlantic Standard Time 598 PST Pacific Standard Time 599 PST8PDT Pacific Standard Time 600 ROC Taipei Standard Time 601 ROK Korean Standard Time 602 Singapore Singapore Standard Time 603 SST Solomon Islands Time 604 SystemV/AST4 GMT-04:00 605 SystemV/AST4ADT GMT-04:00 606 SystemV/CST6 GMT-06:00 607 SystemV/CST6CDT GMT-06:00 608 SystemV/EST5 GMT-05:00 609 SystemV/EST5EDT GMT-05:00 610 SystemV/HST10 GMT-10:00 611 SystemV/MST7 GMT-07:00 612 SystemV/MST7MDT GMT-07:00 613 SystemV/PST8 GMT-08:00 614 SystemV/PST8PDT GMT-08:00 615 SystemV/YST9 GMT-09:00 616 SystemV/YST9YDT GMT-09:00 617 Turkey GMT+03:00 618 UCT Coordinated Universal Time 619 Universal Coordinated Universal Time 620 US/Alaska Alaska Standard Time 621 US/Aleutian Hawaii-Aleutian Standard Time 622 US/Arizona Mountain Standard Time 623 US/Central Central Standard Time 624 US/East-Indiana Eastern Standard Time 625 US/Eastern Eastern Standard Time 626 US/Hawaii Hawaii-Aleutian Standard Time 627 US/Indiana-Starke Central Standard Time 628 US/Michigan Eastern Standard Time 629 US/Mountain Mountain Standard Time 630 US/Pacific Pacific Standard Time 631 US/Pacific-New Pacific Standard Time 632 US/Samoa Samoa Standard Time 633 UTC Coordinated Universal Time 634 VST Indochina Time 635 W-SU Moscow Standard Time 636 WET GMT 637 Zulu Coordinated Universal Time Name.Daylight Name.Windows 1 AUS Central Standard Time 2 Australian Eastern Daylight Time AUS Eastern Standard Time 3 Greenwich Standard Time 4 Greenwich Standard Time 5 E. Africa Standard Time 6 W. Central Africa Standard Time 7 E. Africa Standard Time 8 E. Africa Standard Time 9 Greenwich Standard Time 10 W. Central Africa Standard Time 11 Greenwich Standard Time 12 Greenwich Standard Time 13 South Africa Standard Time 14 W. Central Africa Standard Time 15 South Africa Standard Time 16 Eastern European Summer Time Egypt Standard Time 17 GMT+01:00 Morocco Standard Time 18 Central European Summer Time Romance Standard Time 19 Greenwich Standard Time 20 Greenwich Standard Time 21 E. Africa Standard Time 22 E. Africa Standard Time 23 W. Central Africa Standard Time 24 GMT+01:00 Morocco Standard Time 25 Greenwich Standard Time 26 South Africa Standard Time 27 South Africa Standard Time 28 South Africa Standard Time 29 South Sudan Standard Time 30 E. Africa Standard Time 31 Sudan Standard Time 32 South Africa Standard Time 33 W. Central Africa Standard Time 34 W. Central Africa Standard Time 35 W. Central Africa Standard Time 36 Greenwich Standard Time 37 W. Central Africa Standard Time 38 South Africa Standard Time 39 South Africa Standard Time 40 W. Central Africa Standard Time 41 South Africa Standard Time 42 South Africa Standard Time 43 South Africa Standard Time 44 E. Africa Standard Time 45 Greenwich Standard Time 46 E. Africa Standard Time 47 W. Central Africa Standard Time 48 W. Central Africa Standard Time 49 Greenwich Standard Time 50 Greenwich Standard Time 51 W. Central Africa Standard Time 52 Sao Tome Standard Time 53 Greenwich Standard Time 54 Libya Standard Time 55 W. Central Africa Standard Time 56 Namibia Standard Time 57 Argentina Standard Time 58 Hawaii-Aleutian Daylight Time Aleutian Standard Time 59 Alaska Daylight Time Alaskan Standard Time 60 SA Western Standard Time 61 SA Western Standard Time 62 Tocantins Standard Time 63 Argentina Standard Time 64 Argentina Standard Time 65 Argentina Standard Time 66 Argentina Standard Time 67 Argentina Standard Time 68 Argentina Standard Time 69 Argentina Standard Time 70 Argentina Standard Time 71 Argentina Standard Time 72 Argentina Standard Time 73 Argentina Standard Time 74 Argentina Standard Time 75 Argentina Standard Time 76 SA Western Standard Time 77 Paraguay Summer Time Paraguay Standard Time 78 SA Pacific Standard Time 79 Hawaii-Aleutian Daylight Time Aleutian Standard Time 80 Bahia Standard Time 81 Central Standard Time (Mexico) 82 SA Western Standard Time 83 SA Eastern Standard Time 84 Central America Standard Time 85 SA Western Standard Time 86 SA Western Standard Time 87 SA Pacific Standard Time 88 Mountain Daylight Time Mountain Standard Time 89 Argentina Standard Time 90 Mountain Daylight Time Mountain Standard Time 91 Central Brazilian Standard Time 92 Eastern Standard Time (Mexico) 93 Venezuela Standard Time 94 Argentina Standard Time 95 SA Eastern Standard Time 96 SA Pacific Standard Time 97 Central Daylight Time Central Standard Time 98 Central Standard Time (Mexico) 99 Mountain Daylight Time Mountain Standard Time 100 SA Pacific Standard Time 101 Argentina Standard Time 102 Central America Standard Time 103 US Mountain Standard Time 104 Central Brazilian Standard Time 105 SA Western Standard Time 106 Greenwich Standard Time 107 Yukon Standard Time 108 US Mountain Standard Time 109 Mountain Daylight Time Mountain Standard Time 110 Eastern Daylight Time Eastern Standard Time 111 SA Western Standard Time 112 Mountain Daylight Time Mountain Standard Time 113 SA Pacific Standard Time 114 Central America Standard Time 115 Pacific Daylight Time Pacific Standard Time (Mexico) 116 US Mountain Standard Time 117 Eastern Daylight Time US Eastern Standard Time 118 SA Eastern Standard Time 119 Atlantic Daylight Time Atlantic Standard Time 120 West Greenland Summer Time Greenland Standard Time 121 Atlantic Daylight Time Atlantic Standard Time 122 Eastern Daylight Time Turks And Caicos Standard Time 123 SA Western Standard Time 124 SA Western Standard Time 125 Central America Standard Time 126 SA Pacific Standard Time 127 SA Western Standard Time 128 Atlantic Daylight Time Atlantic Standard Time 129 Cuba Daylight Time Cuba Standard Time 130 US Mountain Standard Time 131 Eastern Daylight Time US Eastern Standard Time 132 Central Daylight Time Central Standard Time 133 Eastern Daylight Time US Eastern Standard Time 134 Eastern Daylight Time Eastern Standard Time 135 Central Daylight Time Central Standard Time 136 Eastern Daylight Time US Eastern Standard Time 137 Eastern Daylight Time Eastern Standard Time 138 Eastern Daylight Time Eastern Standard Time 139 Eastern Daylight Time US Eastern Standard Time 140 Mountain Daylight Time Mountain Standard Time 141 Eastern Daylight Time Eastern Standard Time 142 SA Pacific Standard Time 143 Argentina Standard Time 144 Alaska Daylight Time Alaskan Standard Time 145 Eastern Daylight Time Eastern Standard Time 146 Eastern Daylight Time Eastern Standard Time 147 Central Daylight Time Central Standard Time 148 SA Western Standard Time 149 SA Western Standard Time 150 SA Pacific Standard Time 151 Pacific Daylight Time Pacific Standard Time 152 Eastern Daylight Time Eastern Standard Time 153 SA Western Standard Time 154 SA Eastern Standard Time 155 Central America Standard Time 156 SA Western Standard Time 157 SA Western Standard Time 158 SA Western Standard Time 159 Central Daylight Time Central Standard Time 160 Mountain Standard Time (Mexico) 161 Argentina Standard Time 162 Central Daylight Time Central Standard Time 163 Central Standard Time (Mexico) 164 Alaska Daylight Time Alaskan Standard Time 165 Central Standard Time (Mexico) 166 St Pierre & Miquelon Daylight Time Saint Pierre Standard Time 167 Atlantic Daylight Time Atlantic Standard Time 168 Central Standard Time (Mexico) 169 Montevideo Standard Time 170 Eastern Daylight Time Eastern Standard Time 171 SA Western Standard Time 172 Eastern Daylight Time Eastern Standard Time 173 Eastern Daylight Time Eastern Standard Time 174 Eastern Daylight Time Eastern Standard Time 175 Alaska Daylight Time Alaskan Standard Time 176 UTC-02 177 Central Daylight Time Central Standard Time 178 Central Daylight Time Central Standard Time 179 Central Daylight Time Central Standard Time 180 West Greenland Summer Time Greenland Standard Time 181 Central Daylight Time Central Standard Time 182 SA Pacific Standard Time 183 Eastern Daylight Time Eastern Standard Time 184 SA Eastern Standard Time 185 US Mountain Standard Time 186 SA Western Standard Time 187 Eastern Daylight Time Haiti Standard Time 188 SA Pacific Standard Time 189 SA Western Standard Time 190 SA Western Standard Time 191 Magallanes Standard Time 192 Central Daylight Time Central Standard Time 193 Central Daylight Time Central Standard Time 194 SA Eastern Standard Time 195 Canada Central Standard Time 196 Central Daylight Time Central Standard Time 197 SA Pacific Standard Time 198 Argentina Standard Time 199 Pacific Daylight Time Pacific Standard Time (Mexico) 200 SA Eastern Standard Time 201 Chile Summer Time Pacific SA Standard Time 202 SA Western Standard Time 203 E. South America Standard Time 204 East Greenland Summer Time Azores Standard Time 205 Mountain Daylight Time Mountain Standard Time 206 Alaska Daylight Time Alaskan Standard Time 207 SA Western Standard Time 208 Newfoundland Daylight Time Newfoundland Standard Time 209 SA Western Standard Time 210 SA Western Standard Time 211 SA Western Standard Time 212 SA Western Standard Time 213 Canada Central Standard Time 214 Central America Standard Time 215 Atlantic Daylight Time Atlantic Standard Time 216 Eastern Daylight Time Eastern Standard Time 217 Pacific Daylight Time Pacific Standard Time (Mexico) 218 Eastern Daylight Time Eastern Standard Time 219 SA Western Standard Time 220 Pacific Daylight Time Pacific Standard Time 221 SA Western Standard Time 222 Yukon Standard Time 223 Central Daylight Time Central Standard Time 224 Alaska Daylight Time Alaskan Standard Time 225 Mountain Daylight Time Mountain Standard Time 226 Central Pacific Standard Time 227 SE Asia Standard Time 228 West Pacific Standard Time 229 Australian Eastern Daylight Time Tasmania Standard Time 230 West Asia Standard Time 231 New Zealand Daylight Time New Zealand Standard Time 232 SA Eastern Standard Time 233 SA Eastern Standard Time 234 New Zealand Daylight Time New Zealand Standard Time 235 E. Africa Standard Time 236 GMT+02:00 237 Central Asia Standard Time 238 Central European Summer Time W. Europe Standard Time 239 Eastern European Summer Time Egypt Standard Time 240 Arab Standard Time 241 Central Asia Standard Time 242 Jordan Standard Time 243 Russia Time Zone 11 244 West Asia Standard Time 245 West Asia Standard Time 246 West Asia Standard Time 247 West Asia Standard Time 248 West Asia Standard Time 249 Arabic Standard Time 250 Arab Standard Time 251 Azerbaijan Standard Time 252 SE Asia Standard Time 253 Altai Standard Time 254 Eastern European Summer Time Middle East Standard Time 255 Central Asia Standard Time 256 Singapore Standard Time 257 India Standard Time 258 Transbaikal Standard Time 259 Ulaanbaatar Standard Time 260 China Standard Time 261 China Standard Time 262 Sri Lanka Standard Time 263 Bangladesh Standard Time 264 Syria Standard Time 265 Bangladesh Standard Time 266 Tokyo Standard Time 267 Arabian Standard Time 268 West Asia Standard Time 269 GMT+03:00 GTB Standard Time 270 Eastern European Summer Time West Bank Standard Time 271 China Standard Time 272 Eastern European Summer Time West Bank Standard Time 273 SE Asia Standard Time 274 China Standard Time 275 W. Mongolia Standard Time 276 North Asia East Standard Time 277 Turkey Standard Time 278 SE Asia Standard Time 279 Tokyo Standard Time 280 Israel Daylight Time Israel Standard Time 281 Afghanistan Standard Time 282 Russia Time Zone 11 283 Pakistan Standard Time 284 Central Asia Standard Time 285 Nepal Standard Time 286 Nepal Standard Time 287 Yakutsk Standard Time 288 India Standard Time 289 North Asia Standard Time 290 Singapore Standard Time 291 Singapore Standard Time 292 Arab Standard Time 293 China Standard Time 294 China Standard Time 295 Magadan Standard Time 296 Singapore Standard Time 297 Singapore Standard Time 298 Arabian Standard Time 299 Eastern European Summer Time GTB Standard Time 300 North Asia Standard Time 301 N. Central Asia Standard Time 302 Omsk Standard Time 303 West Asia Standard Time 304 SE Asia Standard Time 305 SE Asia Standard Time 306 North Korea Standard Time 307 Arab Standard Time 308 Central Asia Standard Time 309 Qyzylorda Standard Time 310 Myanmar Standard Time 311 Arab Standard Time 312 SE Asia Standard Time 313 Sakhalin Standard Time 314 West Asia Standard Time 315 Korea Standard Time 316 China Standard Time 317 Singapore Standard Time 318 Russia Time Zone 10 319 Taipei Standard Time 320 West Asia Standard Time 321 Georgian Standard Time 322 Iran Standard Time 323 Israel Daylight Time Israel Standard Time 324 Bangladesh Standard Time 325 Bangladesh Standard Time 326 Tokyo Standard Time 327 Tomsk Standard Time 328 Singapore Standard Time 329 Ulaanbaatar Standard Time 330 Ulaanbaatar Standard Time 331 Central Asia Standard Time 332 Vladivostok Standard Time 333 SE Asia Standard Time 334 Vladivostok Standard Time 335 Yakutsk Standard Time 336 Myanmar Standard Time 337 Ekaterinburg Standard Time 338 Caucasus Standard Time 339 Alaska Daylight Time Alaskan Standard Time 340 Azores Summer Time Azores Standard Time 341 Atlantic Daylight Time Atlantic Standard Time 342 Western European Summer Time GMT Standard Time 343 Cape Verde Standard Time 344 Western European Summer Time GMT Standard Time 345 Western European Summer Time GMT Standard Time 346 Central European Summer Time W. Europe Standard Time 347 Western European Summer Time GMT Standard Time 348 Greenwich Standard Time 349 UTC-02 350 Greenwich Standard Time 351 SA Eastern Standard Time 352 Australian Eastern Daylight Time AUS Eastern Standard Time 353 Australian Central Daylight Time Cen. Australia Standard Time 354 E. Australia Standard Time 355 Australian Central Daylight Time Cen. Australia Standard Time 356 Australian Eastern Daylight Time AUS Eastern Standard Time 357 Australian Eastern Daylight Time Tasmania Standard Time 358 AUS Central Standard Time 359 Aus Central W. Standard Time 360 Australian Eastern Daylight Time Tasmania Standard Time 361 Lord Howe Daylight Time Lord Howe Standard Time 362 E. Australia Standard Time 363 Lord Howe Daylight Time Lord Howe Standard Time 364 Australian Eastern Daylight Time AUS Eastern Standard Time 365 AUS Central Standard Time 366 Australian Eastern Daylight Time AUS Eastern Standard Time 367 W. Australia Standard Time 368 E. Australia Standard Time 369 Australian Central Daylight Time Cen. Australia Standard Time 370 Australian Eastern Daylight Time AUS Eastern Standard Time 371 Australian Eastern Daylight Time Tasmania Standard Time 372 Australian Eastern Daylight Time AUS Eastern Standard Time 373 W. Australia Standard Time 374 Australian Central Daylight Time Cen. Australia Standard Time 375 E. South America Standard Time 376 SA Pacific Standard Time 377 UTC-02 378 E. South America Standard Time 379 SA Western Standard Time 380 Bangladesh Standard Time 381 Atlantic Daylight Time Atlantic Standard Time 382 Central Daylight Time Central Standard Time 383 Canada Central Standard Time 384 Eastern Daylight Time Eastern Standard Time 385 Mountain Daylight Time Mountain Standard Time 386 Newfoundland Daylight Time Newfoundland Standard Time 387 Pacific Daylight Time Pacific Standard Time 388 Canada Central Standard Time 389 Yukon Standard Time 390 South Africa Standard Time 391 GMT+02:00 392 Chile Summer Time Pacific SA Standard Time 393 Easter Island Summer Time Easter Island Standard Time 394 Newfoundland Daylight Time Newfoundland Standard Time 395 Central Daylight Time Central Standard Time 396 Central Daylight Time Central Standard Time 397 China Standard Time 398 Cuba Daylight Time Cuba Standard Time 399 E. Africa Standard Time 400 Central European Summer Time Romance Standard Time 401 GMT+03:00 402 Eastern European Summer Time Egypt Standard Time 403 Irish Standard Time GMT Standard Time 404 SA Pacific Standard Time 405 Eastern Daylight Time Eastern Standard Time 406 UTC 407 UTC 408 W. Central Africa Standard Time 409 South Africa Standard Time 410 E. Africa Standard Time 411 Arabian Standard Time 412 West Asia Standard Time 413 Central Asia Standard Time 414 SE Asia Standard Time 415 Singapore Standard Time 416 Tokyo Standard Time 417 West Pacific Standard Time 418 Central Pacific Standard Time 419 UTC+12 420 UTC+13 421 Line Islands Standard Time 422 UTC 423 Cape Verde Standard Time 424 UTC-02 425 SA Eastern Standard Time 426 SA Western Standard Time 427 SA Pacific Standard Time 428 Central America Standard Time 429 US Mountain Standard Time 430 UTC-08 431 UTC-09 432 Hawaiian Standard Time 433 UTC-11 434 Dateline Standard Time 435 UTC 436 UTC 437 UTC 438 UTC 439 UTC 440 UTC 441 Central European Summer Time W. Europe Standard Time 442 Central European Summer Time W. Europe Standard Time 443 Astrakhan Standard Time 444 Eastern European Summer Time GTB Standard Time 445 British Summer Time GMT Standard Time 446 Central European Summer Time Central Europe Standard Time 447 Central European Summer Time W. Europe Standard Time 448 Central European Summer Time Central Europe Standard Time 449 Central European Summer Time Romance Standard Time 450 Eastern European Summer Time GTB Standard Time 451 Central European Summer Time Central Europe Standard Time 452 Central European Summer Time W. Europe Standard Time 453 Eastern European Summer Time E. Europe Standard Time 454 Central European Summer Time Romance Standard Time 455 Irish Standard Time GMT Standard Time 456 Central European Summer Time W. Europe Standard Time 457 GMT+01:00 GMT Standard Time 458 Eastern European Summer Time FLE Standard Time 459 GMT+01:00 GMT Standard Time 460 Turkey Standard Time 461 GMT+01:00 GMT Standard Time 462 Kaliningrad Standard Time 463 Eastern European Summer Time FLE Standard Time 464 Russian Standard Time 465 Eastern European Summer Time FLE Standard Time 466 Western European Summer Time GMT Standard Time 467 Central European Summer Time Central Europe Standard Time 468 British Summer Time GMT Standard Time 469 Central European Summer Time W. Europe Standard Time 470 Central European Summer Time Romance Standard Time 471 Central European Summer Time W. Europe Standard Time 472 Eastern European Summer Time FLE Standard Time 473 Belarus Standard Time 474 Central European Summer Time W. Europe Standard Time 475 Russian Standard Time 476 Eastern European Summer Time GTB Standard Time 477 Central European Summer Time W. Europe Standard Time 478 Central European Summer Time Romance Standard Time 479 Central European Summer Time Central Europe Standard Time 480 Central European Summer Time Central Europe Standard Time 481 Eastern European Summer Time FLE Standard Time 482 Central European Summer Time W. Europe Standard Time 483 Russia Time Zone 3 484 Central European Summer Time W. Europe Standard Time 485 Central European Summer Time Central European Standard Time 486 Saratov Standard Time 487 Russian Standard Time 488 Central European Summer Time Central European Standard Time 489 Eastern European Summer Time FLE Standard Time 490 Central European Summer Time W. Europe Standard Time 491 Eastern European Summer Time FLE Standard Time 492 Central European Summer Time Central Europe Standard Time 493 Eastern European Summer Time E. Europe Standard Time 494 Astrakhan Standard Time 495 Eastern European Summer Time FLE Standard Time 496 Central European Summer Time W. Europe Standard Time 497 Central European Summer Time W. Europe Standard Time 498 Central European Summer Time W. Europe Standard Time 499 Eastern European Summer Time FLE Standard Time 500 Volgograd Standard Time 501 Central European Summer Time Central European Standard Time 502 Central European Summer Time Central European Standard Time 503 Eastern European Summer Time FLE Standard Time 504 Central European Summer Time W. Europe Standard Time 505 506 British Summer Time GMT Standard Time 507 British Summer Time GMT Standard Time 508 UTC 509 UTC 510 UTC 511 UTC 512 UTC 513 China Standard Time 514 Hawaiian Standard Time 515 Greenwich Standard Time 516 Eastern Daylight Time US Eastern Standard Time 517 E. Africa Standard Time 518 Central Asia Standard Time 519 SE Asia Standard Time 520 Myanmar Standard Time 521 E. Africa Standard Time 522 West Asia Standard Time 523 Mauritius Standard Time 524 West Asia Standard Time 525 Mauritius Standard Time 526 E. Africa Standard Time 527 Mauritius Standard Time 528 Iran Standard Time 529 Israel Daylight Time Israel Standard Time 530 India Standard Time 531 SA Pacific Standard Time 532 Tokyo Standard Time 533 Tokyo Standard Time 534 UTC+12 535 Libya Standard Time 536 GMT+02:00 537 Pacific Daylight Time Pacific Standard Time (Mexico) 538 Mountain Standard Time (Mexico) 539 Central Standard Time (Mexico) 540 Samoa Standard Time 541 US Mountain Standard Time 542 Mountain Daylight Time Mountain Standard Time 543 Mountain Daylight Time Mountain Standard Time 544 Caucasus Standard Time 545 New Zealand Daylight Time New Zealand Standard Time 546 New Zealand Daylight Time New Zealand Standard Time 547 Chatham Daylight Time Chatham Islands Standard Time 548 Samoa Standard Time 549 New Zealand Daylight Time New Zealand Standard Time 550 Bougainville Standard Time 551 Chatham Daylight Time Chatham Islands Standard Time 552 West Pacific Standard Time 553 Easter Island Summer Time Easter Island Standard Time 554 Central Pacific Standard Time 555 UTC+13 556 UTC+13 557 Fiji Standard Time 558 UTC+12 559 Central America Standard Time 560 UTC-09 561 Central Pacific Standard Time 562 West Pacific Standard Time 563 Hawaiian Standard Time 564 Hawaiian Standard Time 565 UTC+13 566 Line Islands Standard Time 567 Central Pacific Standard Time 568 UTC+12 569 UTC+12 570 Marquesas Standard Time 571 UTC-11 572 UTC+12 573 UTC-11 574 Norfolk Island Daylight Time Norfolk Standard Time 575 Central Pacific Standard Time 576 UTC-11 577 Tokyo Standard Time 578 UTC-08 579 Central Pacific Standard Time 580 Central Pacific Standard Time 581 West Pacific Standard Time 582 Hawaiian Standard Time 583 West Pacific Standard Time 584 UTC-11 585 Hawaiian Standard Time 586 UTC+12 587 Tonga Standard Time 588 West Pacific Standard Time 589 UTC+12 590 UTC+12 591 West Pacific Standard Time 592 Pakistan Standard Time 593 US Mountain Standard Time 594 Central European Summer Time Central European Standard Time 595 Western European Summer Time GMT Standard Time 596 China Standard Time 597 SA Western Standard Time 598 Pacific Daylight Time Pacific Standard Time 599 Pacific Daylight Time Pacific Standard Time 600 Taipei Standard Time 601 Korea Standard Time 602 Singapore Standard Time 603 Central Pacific Standard Time 604 605 GMT-03:00 606 607 GMT-05:00 608 609 GMT-04:00 610 611 612 GMT-06:00 613 614 GMT-07:00 615 616 GMT-08:00 617 Turkey Standard Time 618 UTC 619 UTC 620 Alaska Daylight Time Alaskan Standard Time 621 Hawaii-Aleutian Daylight Time Aleutian Standard Time 622 US Mountain Standard Time 623 Central Daylight Time Central Standard Time 624 Eastern Daylight Time US Eastern Standard Time 625 Eastern Daylight Time Eastern Standard Time 626 Hawaiian Standard Time 627 Central Daylight Time Central Standard Time 628 Eastern Daylight Time Eastern Standard Time 629 Mountain Daylight Time Mountain Standard Time 630 Pacific Daylight Time Pacific Standard Time 631 Pacific Daylight Time Pacific Standard Time 632 UTC-11 633 UTC 634 SE Asia Standard Time 635 Russian Standard Time 636 GMT+01:00 637 UTC RawOffset UsesDaylightTime 1 9.50 FALSE 2 10.00 TRUE 3 0.00 FALSE 4 0.00 FALSE 5 3.00 FALSE 6 1.00 FALSE 7 3.00 FALSE 8 3.00 FALSE 9 0.00 FALSE 10 1.00 FALSE 11 0.00 FALSE 12 0.00 FALSE 13 2.00 FALSE 14 1.00 FALSE 15 2.00 FALSE 16 2.00 TRUE 17 0.00 TRUE 18 1.00 TRUE 19 0.00 FALSE 20 0.00 FALSE 21 3.00 FALSE 22 3.00 FALSE 23 1.00 FALSE 24 0.00 TRUE 25 0.00 FALSE 26 2.00 FALSE 27 2.00 FALSE 28 2.00 FALSE 29 2.00 FALSE 30 3.00 FALSE 31 2.00 FALSE 32 2.00 FALSE 33 1.00 FALSE 34 1.00 FALSE 35 1.00 FALSE 36 0.00 FALSE 37 1.00 FALSE 38 2.00 FALSE 39 2.00 FALSE 40 1.00 FALSE 41 2.00 FALSE 42 2.00 FALSE 43 2.00 FALSE 44 3.00 FALSE 45 0.00 FALSE 46 3.00 FALSE 47 1.00 FALSE 48 1.00 FALSE 49 0.00 FALSE 50 0.00 FALSE 51 1.00 FALSE 52 0.00 FALSE 53 0.00 FALSE 54 2.00 FALSE 55 1.00 FALSE 56 2.00 FALSE 57 -3.00 FALSE 58 -10.00 TRUE 59 -9.00 TRUE 60 -4.00 FALSE 61 -4.00 FALSE 62 -3.00 FALSE 63 -3.00 FALSE 64 -3.00 FALSE 65 -3.00 FALSE 66 -3.00 FALSE 67 -3.00 FALSE 68 -3.00 FALSE 69 -3.00 FALSE 70 -3.00 FALSE 71 -3.00 FALSE 72 -3.00 FALSE 73 -3.00 FALSE 74 -3.00 FALSE 75 -3.00 FALSE 76 -4.00 FALSE 77 -4.00 TRUE 78 -5.00 FALSE 79 -10.00 TRUE 80 -3.00 FALSE 81 -6.00 FALSE 82 -4.00 FALSE 83 -3.00 FALSE 84 -6.00 FALSE 85 -4.00 FALSE 86 -4.00 FALSE 87 -5.00 FALSE 88 -7.00 TRUE 89 -3.00 FALSE 90 -7.00 TRUE 91 -4.00 FALSE 92 -5.00 FALSE 93 -4.00 FALSE 94 -3.00 FALSE 95 -3.00 FALSE 96 -5.00 FALSE 97 -6.00 TRUE 98 -6.00 FALSE 99 -7.00 TRUE 100 -5.00 FALSE 101 -3.00 FALSE 102 -6.00 FALSE 103 -7.00 FALSE 104 -4.00 FALSE 105 -4.00 FALSE 106 0.00 FALSE 107 -7.00 FALSE 108 -7.00 FALSE 109 -7.00 TRUE 110 -5.00 TRUE 111 -4.00 FALSE 112 -7.00 TRUE 113 -5.00 FALSE 114 -6.00 FALSE 115 -8.00 TRUE 116 -7.00 FALSE 117 -5.00 TRUE 118 -3.00 FALSE 119 -4.00 TRUE 120 -2.00 TRUE 121 -4.00 TRUE 122 -5.00 TRUE 123 -4.00 FALSE 124 -4.00 FALSE 125 -6.00 FALSE 126 -5.00 FALSE 127 -4.00 FALSE 128 -4.00 TRUE 129 -5.00 TRUE 130 -7.00 FALSE 131 -5.00 TRUE 132 -6.00 TRUE 133 -5.00 TRUE 134 -5.00 TRUE 135 -6.00 TRUE 136 -5.00 TRUE 137 -5.00 TRUE 138 -5.00 TRUE 139 -5.00 TRUE 140 -7.00 TRUE 141 -5.00 TRUE 142 -5.00 FALSE 143 -3.00 FALSE 144 -9.00 TRUE 145 -5.00 TRUE 146 -5.00 TRUE 147 -6.00 TRUE 148 -4.00 FALSE 149 -4.00 FALSE 150 -5.00 FALSE 151 -8.00 TRUE 152 -5.00 TRUE 153 -4.00 FALSE 154 -3.00 FALSE 155 -6.00 FALSE 156 -4.00 FALSE 157 -4.00 FALSE 158 -4.00 FALSE 159 -6.00 TRUE 160 -7.00 FALSE 161 -3.00 FALSE 162 -6.00 TRUE 163 -6.00 FALSE 164 -9.00 TRUE 165 -6.00 FALSE 166 -3.00 TRUE 167 -4.00 TRUE 168 -6.00 FALSE 169 -3.00 FALSE 170 -5.00 TRUE 171 -4.00 FALSE 172 -5.00 TRUE 173 -5.00 TRUE 174 -5.00 TRUE 175 -9.00 TRUE 176 -2.00 FALSE 177 -6.00 TRUE 178 -6.00 TRUE 179 -6.00 TRUE 180 -2.00 TRUE 181 -6.00 TRUE 182 -5.00 FALSE 183 -5.00 TRUE 184 -3.00 FALSE 185 -7.00 FALSE 186 -4.00 FALSE 187 -5.00 TRUE 188 -5.00 FALSE 189 -4.00 FALSE 190 -4.00 FALSE 191 -3.00 FALSE 192 -6.00 TRUE 193 -6.00 TRUE 194 -3.00 FALSE 195 -6.00 FALSE 196 -6.00 TRUE 197 -5.00 FALSE 198 -3.00 FALSE 199 -8.00 TRUE 200 -3.00 FALSE 201 -4.00 TRUE 202 -4.00 FALSE 203 -3.00 FALSE 204 -1.00 TRUE 205 -7.00 TRUE 206 -9.00 TRUE 207 -4.00 FALSE 208 -3.50 TRUE 209 -4.00 FALSE 210 -4.00 FALSE 211 -4.00 FALSE 212 -4.00 FALSE 213 -6.00 FALSE 214 -6.00 FALSE 215 -4.00 TRUE 216 -5.00 TRUE 217 -8.00 TRUE 218 -5.00 TRUE 219 -4.00 FALSE 220 -8.00 TRUE 221 -4.00 FALSE 222 -7.00 FALSE 223 -6.00 TRUE 224 -9.00 TRUE 225 -7.00 TRUE 226 11.00 FALSE 227 7.00 FALSE 228 10.00 FALSE 229 10.00 TRUE 230 5.00 FALSE 231 12.00 TRUE 232 -3.00 FALSE 233 -3.00 FALSE 234 12.00 TRUE 235 3.00 FALSE 236 0.00 TRUE 237 6.00 FALSE 238 1.00 TRUE 239 2.00 TRUE 240 3.00 FALSE 241 6.00 FALSE 242 3.00 FALSE 243 12.00 FALSE 244 5.00 FALSE 245 5.00 FALSE 246 5.00 FALSE 247 5.00 FALSE 248 5.00 FALSE 249 3.00 FALSE 250 3.00 FALSE 251 4.00 FALSE 252 7.00 FALSE 253 7.00 FALSE 254 2.00 TRUE 255 6.00 FALSE 256 8.00 FALSE 257 5.50 FALSE 258 9.00 FALSE 259 8.00 FALSE 260 8.00 FALSE 261 8.00 FALSE 262 5.50 FALSE 263 6.00 FALSE 264 3.00 FALSE 265 6.00 FALSE 266 9.00 FALSE 267 4.00 FALSE 268 5.00 FALSE 269 2.00 TRUE 270 2.00 TRUE 271 8.00 FALSE 272 2.00 TRUE 273 7.00 FALSE 274 8.00 FALSE 275 7.00 FALSE 276 8.00 FALSE 277 3.00 FALSE 278 7.00 FALSE 279 9.00 FALSE 280 2.00 TRUE 281 4.50 FALSE 282 12.00 FALSE 283 5.00 FALSE 284 6.00 FALSE 285 5.75 FALSE 286 5.75 FALSE 287 9.00 FALSE 288 5.50 FALSE 289 7.00 FALSE 290 8.00 FALSE 291 8.00 FALSE 292 3.00 FALSE 293 8.00 FALSE 294 8.00 FALSE 295 11.00 FALSE 296 8.00 FALSE 297 8.00 FALSE 298 4.00 FALSE 299 2.00 TRUE 300 7.00 FALSE 301 7.00 FALSE 302 6.00 FALSE 303 5.00 FALSE 304 7.00 FALSE 305 7.00 FALSE 306 9.00 FALSE 307 3.00 FALSE 308 6.00 FALSE 309 5.00 FALSE 310 6.50 FALSE 311 3.00 FALSE 312 7.00 FALSE 313 11.00 FALSE 314 5.00 FALSE 315 9.00 FALSE 316 8.00 FALSE 317 8.00 FALSE 318 11.00 FALSE 319 8.00 FALSE 320 5.00 FALSE 321 4.00 FALSE 322 3.50 FALSE 323 2.00 TRUE 324 6.00 FALSE 325 6.00 FALSE 326 9.00 FALSE 327 7.00 FALSE 328 8.00 FALSE 329 8.00 FALSE 330 8.00 FALSE 331 6.00 FALSE 332 10.00 FALSE 333 7.00 FALSE 334 10.00 FALSE 335 9.00 FALSE 336 6.50 FALSE 337 5.00 FALSE 338 4.00 FALSE 339 -9.00 TRUE 340 -1.00 TRUE 341 -4.00 TRUE 342 0.00 TRUE 343 -1.00 FALSE 344 0.00 TRUE 345 0.00 TRUE 346 1.00 TRUE 347 0.00 TRUE 348 0.00 FALSE 349 -2.00 FALSE 350 0.00 FALSE 351 -3.00 FALSE 352 10.00 TRUE 353 9.50 TRUE 354 10.00 FALSE 355 9.50 TRUE 356 10.00 TRUE 357 10.00 TRUE 358 9.50 FALSE 359 8.75 FALSE 360 10.00 TRUE 361 10.50 TRUE 362 10.00 FALSE 363 10.50 TRUE 364 10.00 TRUE 365 9.50 FALSE 366 10.00 TRUE 367 8.00 FALSE 368 10.00 FALSE 369 9.50 TRUE 370 10.00 TRUE 371 10.00 TRUE 372 10.00 TRUE 373 8.00 FALSE 374 9.50 TRUE 375 -3.00 FALSE 376 -5.00 FALSE 377 -2.00 FALSE 378 -3.00 FALSE 379 -4.00 FALSE 380 6.00 FALSE 381 -4.00 TRUE 382 -6.00 TRUE 383 -6.00 FALSE 384 -5.00 TRUE 385 -7.00 TRUE 386 -3.50 TRUE 387 -8.00 TRUE 388 -6.00 FALSE 389 -7.00 FALSE 390 2.00 FALSE 391 1.00 TRUE 392 -4.00 TRUE 393 -6.00 TRUE 394 -3.50 TRUE 395 -6.00 TRUE 396 -6.00 TRUE 397 8.00 FALSE 398 -5.00 TRUE 399 3.00 FALSE 400 1.00 TRUE 401 2.00 TRUE 402 2.00 TRUE 403 0.00 TRUE 404 -5.00 FALSE 405 -5.00 TRUE 406 0.00 FALSE 407 0.00 FALSE 408 1.00 FALSE 409 2.00 FALSE 410 3.00 FALSE 411 4.00 FALSE 412 5.00 FALSE 413 6.00 FALSE 414 7.00 FALSE 415 8.00 FALSE 416 9.00 FALSE 417 10.00 FALSE 418 11.00 FALSE 419 12.00 FALSE 420 13.00 FALSE 421 14.00 FALSE 422 0.00 FALSE 423 -1.00 FALSE 424 -2.00 FALSE 425 -3.00 FALSE 426 -4.00 FALSE 427 -5.00 FALSE 428 -6.00 FALSE 429 -7.00 FALSE 430 -8.00 FALSE 431 -9.00 FALSE 432 -10.00 FALSE 433 -11.00 FALSE 434 -12.00 FALSE 435 0.00 FALSE 436 0.00 FALSE 437 0.00 FALSE 438 0.00 FALSE 439 0.00 FALSE 440 0.00 FALSE 441 1.00 TRUE 442 1.00 TRUE 443 4.00 FALSE 444 2.00 TRUE 445 0.00 TRUE 446 1.00 TRUE 447 1.00 TRUE 448 1.00 TRUE 449 1.00 TRUE 450 2.00 TRUE 451 1.00 TRUE 452 1.00 TRUE 453 2.00 TRUE 454 1.00 TRUE 455 0.00 TRUE 456 1.00 TRUE 457 0.00 TRUE 458 2.00 TRUE 459 0.00 TRUE 460 3.00 FALSE 461 0.00 TRUE 462 2.00 FALSE 463 2.00 TRUE 464 3.00 FALSE 465 2.00 TRUE 466 0.00 TRUE 467 1.00 TRUE 468 0.00 TRUE 469 1.00 TRUE 470 1.00 TRUE 471 1.00 TRUE 472 2.00 TRUE 473 3.00 FALSE 474 1.00 TRUE 475 3.00 FALSE 476 2.00 TRUE 477 1.00 TRUE 478 1.00 TRUE 479 1.00 TRUE 480 1.00 TRUE 481 2.00 TRUE 482 1.00 TRUE 483 4.00 FALSE 484 1.00 TRUE 485 1.00 TRUE 486 4.00 FALSE 487 3.00 FALSE 488 1.00 TRUE 489 2.00 TRUE 490 1.00 TRUE 491 2.00 TRUE 492 1.00 TRUE 493 2.00 TRUE 494 4.00 FALSE 495 2.00 TRUE 496 1.00 TRUE 497 1.00 TRUE 498 1.00 TRUE 499 2.00 TRUE 500 3.00 FALSE 501 1.00 TRUE 502 1.00 TRUE 503 2.00 TRUE 504 1.00 TRUE 505 0.00 FALSE 506 0.00 TRUE 507 0.00 TRUE 508 0.00 FALSE 509 0.00 FALSE 510 0.00 FALSE 511 0.00 FALSE 512 0.00 FALSE 513 8.00 FALSE 514 -10.00 FALSE 515 0.00 FALSE 516 -5.00 TRUE 517 3.00 FALSE 518 6.00 FALSE 519 7.00 FALSE 520 6.50 FALSE 521 3.00 FALSE 522 5.00 FALSE 523 4.00 FALSE 524 5.00 FALSE 525 4.00 FALSE 526 3.00 FALSE 527 4.00 FALSE 528 3.50 FALSE 529 2.00 TRUE 530 5.50 FALSE 531 -5.00 FALSE 532 9.00 FALSE 533 9.00 FALSE 534 12.00 FALSE 535 2.00 FALSE 536 1.00 TRUE 537 -8.00 TRUE 538 -7.00 FALSE 539 -6.00 FALSE 540 13.00 FALSE 541 -7.00 FALSE 542 -7.00 TRUE 543 -7.00 TRUE 544 4.00 FALSE 545 12.00 TRUE 546 12.00 TRUE 547 12.75 TRUE 548 13.00 FALSE 549 12.00 TRUE 550 11.00 FALSE 551 12.75 TRUE 552 10.00 FALSE 553 -6.00 TRUE 554 11.00 FALSE 555 13.00 FALSE 556 13.00 FALSE 557 12.00 FALSE 558 12.00 FALSE 559 -6.00 FALSE 560 -9.00 FALSE 561 11.00 FALSE 562 10.00 FALSE 563 -10.00 FALSE 564 -10.00 FALSE 565 13.00 FALSE 566 14.00 FALSE 567 11.00 FALSE 568 12.00 FALSE 569 12.00 FALSE 570 -9.50 FALSE 571 -11.00 FALSE 572 12.00 FALSE 573 -11.00 FALSE 574 11.00 TRUE 575 11.00 FALSE 576 -11.00 FALSE 577 9.00 FALSE 578 -8.00 FALSE 579 11.00 FALSE 580 11.00 FALSE 581 10.00 FALSE 582 -10.00 FALSE 583 10.00 FALSE 584 -11.00 FALSE 585 -10.00 FALSE 586 12.00 FALSE 587 13.00 FALSE 588 10.00 FALSE 589 12.00 FALSE 590 12.00 FALSE 591 10.00 FALSE 592 5.00 FALSE 593 -7.00 FALSE 594 1.00 TRUE 595 0.00 TRUE 596 8.00 FALSE 597 -4.00 FALSE 598 -8.00 TRUE 599 -8.00 TRUE 600 8.00 FALSE 601 9.00 FALSE 602 8.00 FALSE 603 11.00 FALSE 604 -4.00 FALSE 605 -4.00 TRUE 606 -6.00 FALSE 607 -6.00 TRUE 608 -5.00 FALSE 609 -5.00 TRUE 610 -10.00 FALSE 611 -7.00 FALSE 612 -7.00 TRUE 613 -8.00 FALSE 614 -8.00 TRUE 615 -9.00 FALSE 616 -9.00 TRUE 617 3.00 FALSE 618 0.00 FALSE 619 0.00 FALSE 620 -9.00 TRUE 621 -10.00 TRUE 622 -7.00 FALSE 623 -6.00 TRUE 624 -5.00 TRUE 625 -5.00 TRUE 626 -10.00 FALSE 627 -6.00 TRUE 628 -5.00 TRUE 629 -7.00 TRUE 630 -8.00 TRUE 631 -8.00 TRUE 632 -11.00 FALSE 633 0.00 FALSE 634 7.00 FALSE 635 3.00 FALSE 636 0.00 TRUE 637 0.00 FALSE > > > > > cleanEx() > nameEx("stri_timezone_set") > ### * stri_timezone_set > > flush(stderr()); flush(stdout()) > > ### Name: stri_timezone_get > ### Title: Set or Get Default Time Zone in 'stringi' > ### Aliases: stri_timezone_get stri_timezone_set > > ### ** Examples > > ## Not run: > ##D oldtz <- stri_timezone_set('Europe/Warsaw') > ##D # ... many time zone-dependent operations > ##D stri_timezone_set(oldtz) # restore previous default time zone > ## End(Not run) > > > > > cleanEx() > nameEx("stri_trans_casemap") > ### * stri_trans_casemap > > flush(stderr()); flush(stdout()) > > ### Name: stri_trans_tolower > ### Title: Transform Strings with Case Mapping or Folding > ### Aliases: stri_trans_tolower stri_trans_toupper stri_trans_casefold > ### stri_trans_totitle > > ### ** Examples > > stri_trans_toupper('\u00DF', 'de_DE') # small German Eszett / scharfes S [1] "SS" > stri_cmp_eq(stri_trans_toupper('i', 'en_US'), stri_trans_toupper('i', 'tr_TR')) [1] FALSE > stri_trans_toupper(c('abc', '123', '\u0105\u0104')) [1] "ABC" "123" "ĄĄ" > stri_trans_tolower(c('AbC', '123', '\u0105\u0104')) [1] "abc" "123" "ąą" > stri_trans_totitle(c('AbC', '123', '\u0105\u0104')) [1] "Abc" "123" "Ąą" > stri_trans_casefold(c('AbC', '123', '\u0105\u0104')) [1] "abc" "123" "ąą" > stri_trans_totitle('stringi is a FREE R pAcKaGe. WItH NO StrinGS attached.') # word boundary [1] "Stringi Is A Free R Package. With No Strings Attached." > stri_trans_totitle('stringi is a FREE R pAcKaGe. WItH NO StrinGS attached.', type='sentence') [1] "Stringi is a free r package. With no strings attached." > > > > cleanEx() > nameEx("stri_trans_char") > ### * stri_trans_char > > flush(stderr()); flush(stdout()) > > ### Name: stri_trans_char > ### Title: Translate Characters > ### Aliases: stri_trans_char > > ### ** Examples > > stri_trans_char('id.123', '.', '_') [1] "id_123" > stri_trans_char('babaab', 'ab', '01') [1] "101001" > stri_trans_char('GCUACGGAGCUUCGGAGCUAG', 'ACGT', 'TGCA') [1] "CGUTGCCTCGUUGCCTCGUTC" > > > > cleanEx() > nameEx("stri_trans_general") > ### * stri_trans_general > > flush(stderr()); flush(stdout()) > > ### Name: stri_trans_general > ### Title: General Text Transforms, Including Transliteration > ### Aliases: stri_trans_general > > ### ** Examples > > stri_trans_general('gro\u00df', 'latin-ascii') [1] "gross" > stri_trans_general('stringi', 'latin-greek') [1] "στριγγι" > stri_trans_general('stringi', 'latin-cyrillic') [1] "стринги" > stri_trans_general('stringi', 'upper') # see stri_trans_toupper [1] "STRINGI" > stri_trans_general('\u0104', 'nfd; lower') # compound id; see stri_trans_nfd [1] "ą" > stri_trans_general('Marek G\u0105golewski', 'pl-pl_FONIPA') [1] "marɛk ɡɔŋɡɔlɛfski" > stri_trans_general('\u2620', 'any-name') # character name [1] "\\N{SKULL AND CROSSBONES}" > stri_trans_general('\\N{latin small letter a}', 'name-any') # decode name [1] "a" > stri_trans_general('\u2620', 'hex/c') # to hex [1] "\\u2620" > stri_trans_general("\u201C\u2026\u201D \u0105\u015B\u0107\u017C", + "NFKD; NFC; [^\\p{L}] latin-ascii") [1] "\"...\" ąśćż" > > x <- "\uC885\uB85C\uAD6C \uC0AC\uC9C1\uB3D9" > stringi::stri_trans_general(x, "Hangul-Latin") [1] "jonglogu sajigdong" > # Deviate from the ICU rules of romanisation of Korean, > # see https://en.wikipedia.org/wiki/Romanization_of_Korean > id <- " + :: NFD; + \u11A8 > k; + \u11AE > t; + \u11B8 > p; + \u1105 > r; + :: Hangul-Latin; + " > stringi::stri_trans_general(x, id, rules=TRUE) [1] "jongrogu sajikdong" > > > > > > cleanEx() > nameEx("stri_trans_list") > ### * stri_trans_list > > flush(stderr()); flush(stdout()) > > ### Name: stri_trans_list > ### Title: List Available Text Transforms and Transliterators > ### Aliases: stri_trans_list > > ### ** Examples > > stri_trans_list() [1] "Accents-Any" [2] "am_Brai-am_Ethi" [3] "am_Ethi-am_Brai" [4] "am_Ethi-am_Ethi/Geminate" [5] "am_Ethi-d0_Morse" [6] "am_FONIPA-am" [7] "am-am_FONIPA" [8] "am-am_Latn/BGN" [9] "am-ar" [10] "am-chr" [11] "am-fa" [12] "Amharic-Amharic/Geminate" [13] "Amharic-Latin/BGN" [14] "Any-Accents" [15] "Any-am" [16] "Any-am_Brai" [17] "Any-am_Ethi/Geminate" [18] "Any-am_FONIPA" [19] "Any-am_Latn/BGN" [20] "Any-Any" [21] "Any-ar" [22] "Any-ar_Latn/BGN" [23] "Any-Arab" [24] "Any-Arabic" [25] "Any-Armenian" [26] "Any-Armn" [27] "Any-az/BGN" [28] "Any-be_Latn/BGN" [29] "Any-Beng" [30] "Any-Bengali" [31] "Any-bg_Latn/BGN" [32] "Any-blt_FONIPA" [33] "Any-Bopo" [34] "Any-Bopomofo" [35] "Any-Braille/Amharic" [36] "Any-byn_Ethi/Tekie_Alibekit" [37] "Any-byn_Ethi/Xaleget" [38] "Any-byn_Latn/Tekie_Alibekit" [39] "Any-byn_Latn/Xaleget" [40] "Any-CanadianAboriginal" [41] "Any-Cans" [42] "Any-ch_FONIPA" [43] "Any-chr" [44] "Any-chr_FONIPA" [45] "Any-cs_FONIPA" [46] "Any-cy_FONIPA" [47] "Any-Cyrillic" [48] "Any-Cyrl/Gutgarts" [49] "Any-Deva" [50] "Any-Devanagari" [51] "Any-dsb_FONIPA" [52] "Any-dv_Latn/BGN" [53] "Any-el_Latn/BGN" [54] "Any-eo_FONIPA" [55] "Any-es_419_FONIPA" [56] "Any-es_FONIPA" [57] "Any-Ethi/Gutgarts" [58] "Any-Ethiopic" [59] "Any-Ethiopic/Aethiopica" [60] "Any-Ethiopic/ALALOC" [61] "Any-Ethiopic/Beta_Metsehaf" [62] "Any-Ethiopic/IES_JES_1964" [63] "Any-Ethiopic/Lambdin" [64] "Any-Ethiopic/SERA" [65] "Any-Ethiopic/Tekie_Alibekit" [66] "Any-Ethiopic/Williamson" [67] "Any-Ethiopic/Xalaget" [68] "Any-fa" [69] "Any-fa_FONIPA" [70] "Any-fa_Latn/BGN" [71] "Any-FCC" [72] "Any-FCD" [73] "Any-Geor" [74] "Any-Georgian" [75] "Any-Greek" [76] "Any-Greek/UNGEGN" [77] "Any-Grek" [78] "Any-Grek/UNGEGN" [79] "Any-Gujarati" [80] "Any-Gujr" [81] "Any-Gurmukhi" [82] "Any-Guru" [83] "Any-gz_Ethi" [84] "Any-ha_NE" [85] "Any-Hang" [86] "Any-Hangul" [87] "Any-Hans" [88] "Any-Hant" [89] "Any-he_Latn/BGN" [90] "Any-Hebr" [91] "Any-Hebrew" [92] "Any-Hex" [93] "Any-Hex/C" [94] "Any-Hex/Java" [95] "Any-Hex/Perl" [96] "Any-Hex/Unicode" [97] "Any-Hex/XML" [98] "Any-Hex/XML10" [99] "Any-Hira" [100] "Any-Hiragana" [101] "Any-hy_AREVMDA_FONIPA" [102] "Any-hy_FONIPA" [103] "Any-hy_Latn/BGN" [104] "Any-ia_FONIPA" [105] "Any-Jamo" [106] "Any-ka_Latn/BGN" [107] "Any-ka_Latn/BGN_1981" [108] "Any-Kana" [109] "Any-Kannada" [110] "Any-Katakana" [111] "Any-kk_FONIPA" [112] "Any-kk_Latn/BGN" [113] "Any-Knda" [114] "Any-ky_FONIPA" [115] "Any-ky_Latn/BGN" [116] "Any-la_FONIPA" [117] "Any-Latin" [118] "Any-Latn" [119] "Any-Lower" [120] "Any-Malayalam" [121] "Any-mk_Latn/BGN" [122] "Any-Mlym" [123] "Any-mn_Latn/BGN" [124] "Any-mn_Latn/MNS" [125] "Any-my" [126] "Any-my_FONIPA" [127] "Any-my_Latn" [128] "Any-Name" [129] "Any-NFC" [130] "Any-NFD" [131] "Any-NFKC" [132] "Any-NFKD" [133] "Any-Null" [134] "Any-nv_FONIPA" [135] "Any-Oriya" [136] "Any-Orya" [137] "Any-pl_FONIPA" [138] "Any-ps_Latn/BGN" [139] "Any-Publishing" [140] "Any-Remove" [141] "Any-rm_FONIPA_SURSILV" [142] "Any-ro_FONIPA" [143] "Any-ru" [144] "Any-ru_Latn/BGN" [145] "Any-Sarb" [146] "Any-sat_FONIPA" [147] "Any-sgw_Ethi/Gurage_2013" [148] "Any-si_FONIPA" [149] "Any-si_Latn" [150] "Any-sk_FONIPA" [151] "Any-sr_Latn/BGN" [152] "Any-Syrc" [153] "Any-Syriac" [154] "Any-ta_FONIPA" [155] "Any-Tamil" [156] "Any-Taml" [157] "Any-Telu" [158] "Any-Telugu" [159] "Any-Thaa" [160] "Any-Thaana" [161] "Any-Thai" [162] "Any-Title" [163] "Any-tk/BGN" [164] "Any-ug_FONIPA" [165] "Any-uk_Latn/BGN" [166] "Any-und_FONIPA" [167] "Any-und_FONXSAMP" [168] "Any-Upper" [169] "Any-ur" [170] "Any-uz_Cyrl" [171] "Any-uz_Latn" [172] "Any-uz/BGN" [173] "Any-vec_FONIPA" [174] "Any-xh_FONIPA" [175] "Any-yo_BJ" [176] "Any-zh" [177] "Any-zu_FONIPA" [178] "ar-ar_Latn/BGN" [179] "Arab-Latn" [180] "Arabic-Latin" [181] "Arabic-Latin/BGN" [182] "Armenian-Latin" [183] "Armenian-Latin/BGN" [184] "Armn-Latn" [185] "ASCII-Latin" [186] "az_Cyrl-az/BGN" [187] "az-Lower" [188] "az-Title" [189] "az-Upper" [190] "Azerbaijani-Latin/BGN" [191] "be-be_Latn/BGN" [192] "Belarusian-Latin/BGN" [193] "Beng-Arab" [194] "Beng-Deva" [195] "Beng-Gujr" [196] "Beng-Guru" [197] "Beng-Knda" [198] "Beng-Latn" [199] "Beng-Mlym" [200] "Beng-Orya" [201] "Beng-Taml" [202] "Beng-Telu" [203] "Beng-ur" [204] "Bengali-Arabic" [205] "Bengali-Devanagari" [206] "Bengali-Gujarati" [207] "Bengali-Gurmukhi" [208] "Bengali-Kannada" [209] "Bengali-Latin" [210] "Bengali-Malayalam" [211] "Bengali-Oriya" [212] "Bengali-Tamil" [213] "Bengali-Telugu" [214] "bg-bg_Latn/BGN" [215] "blt-blt_FONIPA" [216] "Bopo-Latn" [217] "Bopomofo-Latin" [218] "Braille-Ethiopic/Amharic" [219] "Bulgarian-Latin/BGN" [220] "Burmese-Latin" [221] "byn_Ethi-byn_Latn/Tekie_Alibekit" [222] "byn_Ethi-byn_Latn/Xaleget" [223] "byn_Latn-byn_Ethi/Tekie_Alibekit" [224] "byn_Latn-byn_Ethi/Xaleget" [225] "CanadianAboriginal-Latin" [226] "Cans-Latn" [227] "ch-am" [228] "ch-ar" [229] "ch-ch_FONIPA" [230] "ch-chr" [231] "ch-fa" [232] "chr-chr_FONIPA" [233] "cs_FONIPA-ja" [234] "cs_FONIPA-ko" [235] "cs-am" [236] "cs-ar" [237] "cs-chr" [238] "cs-cs_FONIPA" [239] "cs-fa" [240] "cs-ja" [241] "cs-ko" [242] "cy-cy_FONIPA" [243] "Cyrillic-Ethiopic/Gutgarts" [244] "Cyrillic-Latin" [245] "Cyrl-Ethi/Gutgarts" [246] "Cyrl-Latn" [247] "d0_Morse-am_Ethi" [248] "de-ASCII" [249] "Deva-Arab" [250] "Deva-Beng" [251] "Deva-Gujr" [252] "Deva-Guru" [253] "Deva-Knda" [254] "Deva-Latn" [255] "Deva-Mlym" [256] "Deva-Orya" [257] "Deva-Taml" [258] "Deva-Telu" [259] "Deva-ur" [260] "Devanagari-Arabic" [261] "Devanagari-Bengali" [262] "Devanagari-Gujarati" [263] "Devanagari-Gurmukhi" [264] "Devanagari-Kannada" [265] "Devanagari-Latin" [266] "Devanagari-Malayalam" [267] "Devanagari-Oriya" [268] "Devanagari-Tamil" [269] "Devanagari-Telugu" [270] "Digit-Tone" [271] "dsb-dsb_FONIPA" [272] "dv-dv_Latn/BGN" [273] "el-el_Latn/BGN" [274] "el-Lower" [275] "el-Title" [276] "el-Upper" [277] "eo-am" [278] "eo-ar" [279] "eo-chr" [280] "eo-eo_FONIPA" [281] "eo-fa" [282] "es_419-am" [283] "es_419-ar" [284] "es_419-chr" [285] "es_419-fa" [286] "es_419-ja" [287] "es_419-zh" [288] "es_FONIPA-am" [289] "es_FONIPA-es_419_FONIPA" [290] "es_FONIPA-ja" [291] "es_FONIPA-zh" [292] "es-am" [293] "es-ar" [294] "es-chr" [295] "es-es_FONIPA" [296] "es-fa" [297] "es-ja" [298] "es-zh" [299] "Ethi-Cyrl/Gutgarts" [300] "Ethi-Latn" [301] "Ethi-Latn/Aethiopi" [302] "Ethi-Latn/Aethiopi_Geminate" [303] "Ethi-Latn/ALALOC" [304] "Ethi-Latn/ALALOC_Geminate" [305] "Ethi-Latn/Beta_Metsehaf" [306] "Ethi-Latn/Beta_Metsehaf_Geminate" [307] "Ethi-Latn/ES3842" [308] "Ethi-Latn/IES_JES_1964" [309] "Ethi-Latn/IES_JES_1964_Geminate" [310] "Ethi-Latn/Lambdin" [311] "Ethi-Latn/SERA" [312] "Ethi-Latn/Williamson" [313] "Ethi-sgw_Ethi/Gurage_2013" [314] "Ethiopic-Braille/Amharic" [315] "Ethiopic-Cyrillic/Gutgarts" [316] "Ethiopic-Ethiopic/Gurage" [317] "Ethiopic-Latin" [318] "Ethiopic-Latin/Aethiopica" [319] "Ethiopic-Latin/Aethiopica_Geminate" [320] "Ethiopic-Latin/ALALOC" [321] "Ethiopic-Latin/ALALOC_Geminate" [322] "Ethiopic-Latin/Beta_Metsehaf" [323] "Ethiopic-Latin/BetaMetsehaf_Geminate" [324] "Ethiopic-Latin/ES3842" [325] "Ethiopic-Latin/IES_JES_1964" [326] "Ethiopic-Latin/IES_JES_1964_Geminate" [327] "Ethiopic-Latin/Lambdin" [328] "Ethiopic-Latin/SERA" [329] "Ethiopic-Latin/Tekie_Alibekit" [330] "Ethiopic-Latin/Williamson" [331] "Ethiopic-Latin/Xaleget" [332] "fa-fa_FONIPA" [333] "fa-fa_Latn/BGN" [334] "Fullwidth-Halfwidth" [335] "Geez-Ethiopic" [336] "Geez-Musnad" [337] "Geor-Latn" [338] "Georgian-Latin" [339] "Georgian-Latin/BGN" [340] "Greek-Latin" [341] "Greek-Latin/BGN" [342] "Greek-Latin/UNGEGN" [343] "Grek-Latn" [344] "Grek-Latn/UNGEGN" [345] "Gujarati-Arabic" [346] "Gujarati-Bengali" [347] "Gujarati-Devanagari" [348] "Gujarati-Gurmukhi" [349] "Gujarati-Kannada" [350] "Gujarati-Latin" [351] "Gujarati-Malayalam" [352] "Gujarati-Oriya" [353] "Gujarati-Tamil" [354] "Gujarati-Telugu" [355] "Gujr-Arab" [356] "Gujr-Beng" [357] "Gujr-Deva" [358] "Gujr-Guru" [359] "Gujr-Knda" [360] "Gujr-Latn" [361] "Gujr-Mlym" [362] "Gujr-Orya" [363] "Gujr-Taml" [364] "Gujr-Telu" [365] "Gujr-ur" [366] "Gurage-Ethiopic" [367] "Gurmukhi-Arabic" [368] "Gurmukhi-Bengali" [369] "Gurmukhi-Devanagari" [370] "Gurmukhi-Gujarati" [371] "Gurmukhi-Kannada" [372] "Gurmukhi-Latin" [373] "Gurmukhi-Malayalam" [374] "Gurmukhi-Oriya" [375] "Gurmukhi-Tamil" [376] "Gurmukhi-Telugu" [377] "Guru-Arab" [378] "Guru-Beng" [379] "Guru-Deva" [380] "Guru-Gujr" [381] "Guru-Knda" [382] "Guru-Latn" [383] "Guru-Mlym" [384] "Guru-Orya" [385] "Guru-Taml" [386] "Guru-Telu" [387] "Guru-ur" [388] "gz_Ethi-Sarb" [389] "ha-ha_NE" [390] "Halfwidth-Fullwidth" [391] "Han-Latin" [392] "Han-Latin/Names" [393] "Hang-Latn" [394] "Hangul-Latin" [395] "Hani-Latn" [396] "Hans-Hant" [397] "Hant-Hans" [398] "he-he_Latn/BGN" [399] "Hebr-Latn" [400] "Hebrew-Latin" [401] "Hebrew-Latin/BGN" [402] "Hex-Any" [403] "Hex-Any/C" [404] "Hex-Any/Java" [405] "Hex-Any/Perl" [406] "Hex-Any/Unicode" [407] "Hex-Any/XML" [408] "Hex-Any/XML10" [409] "Hira-Kana" [410] "Hira-Latn" [411] "Hiragana-Katakana" [412] "Hiragana-Latin" [413] "hy_AREVMDA-am" [414] "hy_AREVMDA-ar" [415] "hy_AREVMDA-chr" [416] "hy_AREVMDA-fa" [417] "hy_AREVMDA-hy_AREVMDA_FONIPA" [418] "hy-am" [419] "hy-ar" [420] "hy-chr" [421] "hy-fa" [422] "hy-hy_FONIPA" [423] "hy-hy_Latn/BGN" [424] "ia-am" [425] "ia-ar" [426] "ia-chr" [427] "ia-fa" [428] "ia-ia_FONIPA" [429] "IPA-XSampa" [430] "it-am" [431] "it-ja" [432] "ja_Hrkt-ja_Latn/BGN" [433] "ja_Latn-ko" [434] "ja_Latn-ru" [435] "Jamo-Latin" [436] "Jamo-Latn" [437] "ka-ka_Latn/BGN" [438] "ka-ka_Latn/BGN_1981" [439] "Kana-Hira" [440] "Kana-Latn" [441] "Kannada-Arabic" [442] "Kannada-Bengali" [443] "Kannada-Devanagari" [444] "Kannada-Gujarati" [445] "Kannada-Gurmukhi" [446] "Kannada-Latin" [447] "Kannada-Malayalam" [448] "Kannada-Oriya" [449] "Kannada-Tamil" [450] "Kannada-Telugu" [451] "Katakana-Hiragana" [452] "Katakana-Latin" [453] "Katakana-Latin/BGN" [454] "Kazakh-Latin/BGN" [455] "Kirghiz-Latin/BGN" [456] "kk-am" [457] "kk-ar" [458] "kk-chr" [459] "kk-fa" [460] "kk-kk_FONIPA" [461] "kk-kk_Latn/BGN" [462] "Knda-Arab" [463] "Knda-Beng" [464] "Knda-Deva" [465] "Knda-Gujr" [466] "Knda-Guru" [467] "Knda-Latn" [468] "Knda-Mlym" [469] "Knda-Orya" [470] "Knda-Taml" [471] "Knda-Telu" [472] "Knda-ur" [473] "ko-ko_Latn/BGN" [474] "Korean-Latin/BGN" [475] "ky-am" [476] "ky-ar" [477] "ky-chr" [478] "ky-fa" [479] "ky-ky_FONIPA" [480] "ky-ky_Latn/BGN" [481] "la-la_FONIPA" [482] "Latin-Arabic" [483] "Latin-Armenian" [484] "Latin-ASCII" [485] "Latin-Bengali" [486] "Latin-Bopomofo" [487] "Latin-CanadianAboriginal" [488] "Latin-Cyrillic" [489] "Latin-Devanagari" [490] "Latin-Ethiopic" [491] "Latin-Ethiopic/Aethiopica" [492] "Latin-Ethiopic/ALALOC" [493] "Latin-Ethiopic/Beta_Metsehaf" [494] "Latin-Ethiopic/IES_JES_1964" [495] "Latin-Ethiopic/Lambdin" [496] "Latin-Ethiopic/SERA" [497] "Latin-Ethiopic/Tekie_Alibekit" [498] "Latin-Ethiopic/Williamson" [499] "Latin-Ethiopic/Xalaget" [500] "Latin-Georgian" [501] "Latin-Greek" [502] "Latin-Greek/UNGEGN" [503] "Latin-Gujarati" [504] "Latin-Gurmukhi" [505] "Latin-Hangul" [506] "Latin-Hebrew" [507] "Latin-Hiragana" [508] "Latin-Jamo" [509] "Latin-Kannada" [510] "Latin-Katakana" [511] "Latin-Malayalam" [512] "Latin-NumericPinyin" [513] "Latin-Oriya" [514] "Latin-Russian/BGN" [515] "Latin-Syriac" [516] "Latin-Tamil" [517] "Latin-Telugu" [518] "Latin-Thaana" [519] "Latin-Thai" [520] "Latn-Arab" [521] "Latn-Armn" [522] "Latn-Beng" [523] "Latn-Bopo" [524] "Latn-Cans" [525] "Latn-Cyrl" [526] "Latn-Deva" [527] "Latn-Ethi" [528] "Latn-Ethi/Aethiopi" [529] "Latn-Ethi/ALALOC" [530] "Latn-Ethi/Beta_Metsehaf" [531] "Latn-Ethi/IES_JES_1964" [532] "Latn-Ethi/Lambdin" [533] "Latn-Ethi/SERA" [534] "Latn-Ethi/Williamson" [535] "Latn-Geor" [536] "Latn-Grek" [537] "Latn-Grek/UNGEGN" [538] "Latn-Gujr" [539] "Latn-Guru" [540] "Latn-Hang" [541] "Latn-Hebr" [542] "Latn-Hira" [543] "Latn-Jamo" [544] "Latn-Kana" [545] "Latn-Knda" [546] "Latn-Mlym" [547] "Latn-Orya" [548] "Latn-Syrc" [549] "Latn-Taml" [550] "Latn-Telu" [551] "Latn-Thaa" [552] "Latn-Thai" [553] "lt-Lower" [554] "lt-Title" [555] "lt-Upper" [556] "Macedonian-Latin/BGN" [557] "Malayalam-Arabic" [558] "Malayalam-Bengali" [559] "Malayalam-Devanagari" [560] "Malayalam-Gujarati" [561] "Malayalam-Gurmukhi" [562] "Malayalam-Kannada" [563] "Malayalam-Latin" [564] "Malayalam-Oriya" [565] "Malayalam-Tamil" [566] "Malayalam-Telugu" [567] "Maldivian-Latin/BGN" [568] "mk-mk_Latn/BGN" [569] "Mlym-Arab" [570] "Mlym-Beng" [571] "Mlym-Deva" [572] "Mlym-Gujr" [573] "Mlym-Guru" [574] "Mlym-Knda" [575] "Mlym-Latn" [576] "Mlym-Orya" [577] "Mlym-Taml" [578] "Mlym-Telu" [579] "Mlym-ur" [580] "mn-mn_Latn/BGN" [581] "mn-mn_Latn/MNS" [582] "Mongolian-Latin/BGN" [583] "my-am" [584] "my-ar" [585] "my-chr" [586] "my-fa" [587] "my-my_FONIPA" [588] "my-my_Latn" [589] "my-Zawgyi" [590] "Myanmar-Latin" [591] "Name-Any" [592] "nl-Title" [593] "NumericPinyin-Latin" [594] "NumericPinyin-Pinyin" [595] "nv-nv_FONIPA" [596] "Oriya-Arabic" [597] "Oriya-Bengali" [598] "Oriya-Devanagari" [599] "Oriya-Gujarati" [600] "Oriya-Gurmukhi" [601] "Oriya-Kannada" [602] "Oriya-Latin" [603] "Oriya-Malayalam" [604] "Oriya-Tamil" [605] "Oriya-Telugu" [606] "Orya-Arab" [607] "Orya-Beng" [608] "Orya-Deva" [609] "Orya-Gujr" [610] "Orya-Guru" [611] "Orya-Knda" [612] "Orya-Latn" [613] "Orya-Mlym" [614] "Orya-Taml" [615] "Orya-Telu" [616] "Orya-ur" [617] "Pashto-Latin/BGN" [618] "Persian-Latin/BGN" [619] "Pinyin-NumericPinyin" [620] "pl_FONIPA-ja" [621] "pl-am" [622] "pl-ar" [623] "pl-chr" [624] "pl-fa" [625] "pl-ja" [626] "pl-pl_FONIPA" [627] "ps-ps_Latn/BGN" [628] "Publishing-Any" [629] "rm_SURSILV-am" [630] "rm_SURSILV-ar" [631] "rm_SURSILV-chr" [632] "rm_SURSILV-fa" [633] "rm_SURSILV-rm_FONIPA_SURSILV" [634] "ro_FONIPA-ja" [635] "ro-am" [636] "ro-ar" [637] "ro-chr" [638] "ro-fa" [639] "ro-ja" [640] "ro-ro_FONIPA" [641] "ru_Latn-ru/BGN" [642] "ru-ja" [643] "ru-ru_Latn/BGN" [644] "ru-zh" [645] "Russian-Latin/BGN" [646] "Sarb-gz_Ethi" [647] "sat_Olck-sat_FONIPA" [648] "sat-am" [649] "sat-ar" [650] "sat-chr" [651] "sat-fa" [652] "Serbian-Latin/BGN" [653] "sgw_Ethi-Ethi/Gurage_2013" [654] "si-am" [655] "si-ar" [656] "si-chr" [657] "si-fa" [658] "si-si_FONIPA" [659] "si-si_Latn" [660] "Simplified-Traditional" [661] "sk_FONIPA-ja" [662] "sk-am" [663] "sk-ar" [664] "sk-chr" [665] "sk-fa" [666] "sk-ja" [667] "sk-sk_FONIPA" [668] "sr-sr_Latn/BGN" [669] "Syrc-Latn" [670] "Syriac-Latin" [671] "ta-ta_FONIPA" [672] "Tamil-Arabic" [673] "Tamil-Bengali" [674] "Tamil-Devanagari" [675] "Tamil-Gujarati" [676] "Tamil-Gurmukhi" [677] "Tamil-Kannada" [678] "Tamil-Latin" [679] "Tamil-Malayalam" [680] "Tamil-Oriya" [681] "Tamil-Telugu" [682] "Taml-Arab" [683] "Taml-Beng" [684] "Taml-Deva" [685] "Taml-Gujr" [686] "Taml-Guru" [687] "Taml-Knda" [688] "Taml-Latn" [689] "Taml-Mlym" [690] "Taml-Orya" [691] "Taml-Telu" [692] "Taml-ur" [693] "Telu-Arab" [694] "Telu-Beng" [695] "Telu-Deva" [696] "Telu-Gujr" [697] "Telu-Guru" [698] "Telu-Knda" [699] "Telu-Latn" [700] "Telu-Mlym" [701] "Telu-Orya" [702] "Telu-Taml" [703] "Telu-ur" [704] "Telugu-Arabic" [705] "Telugu-Bengali" [706] "Telugu-Devanagari" [707] "Telugu-Gujarati" [708] "Telugu-Gurmukhi" [709] "Telugu-Kannada" [710] "Telugu-Latin" [711] "Telugu-Malayalam" [712] "Telugu-Oriya" [713] "Telugu-Tamil" [714] "Thaa-Latn" [715] "Thaana-Latin" [716] "Thai-Latin" [717] "Thai-Latn" [718] "tk_Cyrl-tk/BGN" [719] "tlh-am" [720] "tlh-ar" [721] "tlh-chr" [722] "tlh-fa" [723] "tlh-tlh_FONIPA" [724] "Tone-Digit" [725] "tr-Lower" [726] "tr-Title" [727] "tr-Upper" [728] "Traditional-Simplified" [729] "Turkmen-Latin/BGN" [730] "ug-ug_FONIPA" [731] "uk-uk_Latn/BGN" [732] "Ukrainian-Latin/BGN" [733] "und_FONIPA-ar" [734] "und_FONIPA-chr" [735] "und_FONIPA-fa" [736] "und_FONIPA-und_FONXSAMP" [737] "und_FONXSAMP-und_FONIPA" [738] "uz_Cyrl-uz_Latn" [739] "uz_Cyrl-uz/BGN" [740] "uz_Latn-uz_Cyrl" [741] "Uzbek-Latin/BGN" [742] "vec-vec_FONIPA" [743] "xh-am" [744] "xh-ar" [745] "xh-chr" [746] "xh-fa" [747] "xh-xh_FONIPA" [748] "XSampa-IPA" [749] "yo-yo_BJ" [750] "Zawgyi-my" [751] "zh_Latn_PINYIN-ru" [752] "zu-am" [753] "zu-ar" [754] "zu-chr" [755] "zu-fa" [756] "zu-zu_FONIPA" > > > > > cleanEx() > nameEx("stri_trans_nf") > ### * stri_trans_nf > > flush(stderr()); flush(stdout()) > > ### Name: stri_trans_nfc > ### Title: Perform or Check For Unicode Normalization > ### Aliases: stri_trans_nfc stri_trans_nfd stri_trans_nfkd stri_trans_nfkc > ### stri_trans_nfkc_casefold stri_trans_isnfc stri_trans_isnfd > ### stri_trans_isnfkd stri_trans_isnfkc stri_trans_isnfkc_casefold > > ### ** Examples > > stri_trans_nfd('\u0105') # a with ogonek -> a, ogonek [1] "ą" > stri_trans_nfkc('\ufdfa') # 1 codepoint -> 18 codepoints [1] "صلى الله عليه وسلم" > > > > > cleanEx() > nameEx("stri_trim") > ### * stri_trim > > flush(stderr()); flush(stdout()) > > ### Name: stri_trim_both > ### Title: Trim Characters from the Left and/or Right Side of a String > ### Aliases: stri_trim_both stri_trim stri_trim_left stri_trim_right > > ### ** Examples > > stri_trim_left(' aaa') [1] "aaa" > stri_trim_right('r-project.org/', '\\P{P}') [1] "r-project.org" > stri_trim_both(' Total of 23.5 bitcoins. ', '\\p{N}') [1] "23.5" > stri_trim_both(' Total of 23.5 bitcoins. ', '\\P{N}', negate=TRUE) [1] "23.5" > > > > > cleanEx() > nameEx("stri_unescape_unicode") > ### * stri_unescape_unicode > > flush(stderr()); flush(stdout()) > > ### Name: stri_unescape_unicode > ### Title: Un-escape All Escape Sequences > ### Aliases: stri_unescape_unicode > > ### ** Examples > > stri_unescape_unicode('a\\u0105!\\u0032\\n') [1] "aą!2\n" > > > > > cleanEx() > nameEx("stri_unique") > ### * stri_unique > > flush(stderr()); flush(stdout()) > > ### Name: stri_unique > ### Title: Extract Unique Elements > ### Aliases: stri_unique > > ### ** Examples > > # normalized and non-Unicode-normalized version of the same code point: > stri_unique(c('\u0105', stri_trans_nfkd('\u0105'))) [1] "ą" > unique(c('\u0105', stri_trans_nfkd('\u0105'))) [1] "ą" "ą" > > stri_unique(c('gro\u00df', 'GROSS', 'Gro\u00df', 'Gross'), strength=1) [1] "groß" > > > > > cleanEx() > nameEx("stri_width") > ### * stri_width > > flush(stderr()); flush(stdout()) > > ### Name: stri_width > ### Title: Determine the Width of Code Points > ### Aliases: stri_width > > ### ** Examples > > stri_width(LETTERS[1:5]) [1] 1 1 1 1 1 > stri_width(stri_trans_nfkd('\u0105')) [1] 1 > stri_width(stri_trans_nfkd('\U0001F606')) [1] 2 > stri_width( # Full-width equivalents of ASCII characters: + stri_enc_fromutf32(as.list(c(0x3000, 0xFF01:0xFF5E))) + ) [1] 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 [39] 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 [77] 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 > stri_width(stri_trans_nfkd('\ubc1f')) # includes Hangul Jamo medial vowels and final consonants [1] 2 > > > > cleanEx() > nameEx("stri_wrap") > ### * stri_wrap > > flush(stderr()); flush(stdout()) > > ### Name: stri_wrap > ### Title: Word Wrap Text to Format Paragraphs > ### Aliases: stri_wrap > > ### ** Examples > > s <- stri_paste( + 'Lorem ipsum dolor sit amet, consectetur adipisicing elit. Proin ', + 'nibh augue, suscipit a, scelerisque sed, lacinia in, mi. Cras vel ', + 'lorem. Etiam pellentesque aliquet tellus.') > cat(stri_wrap(s, 20, 0.0), sep='\n') # greedy Lorem ipsum dolor sit amet, consectetur adipisicing elit. Proin nibh augue, suscipit a, scelerisque sed, lacinia in, mi. Cras vel lorem. Etiam pellentesque aliquet tellus. > cat(stri_wrap(s, 20, 2.0), sep='\n') # dynamic Lorem ipsum dolor sit amet, consectetur adipisicing elit. Proin nibh augue, suscipit a, scelerisque sed, lacinia in, mi. Cras vel lorem. Etiam pellentesque aliquet tellus. > cat(stri_pad(stri_wrap(s), side='both'), sep='\n') Lorem ipsum dolor sit amet, consectetur adipisicing elit. Proin nibh augue, suscipit a, scelerisque sed, lacinia in, mi. Cras vel lorem. Etiam pellentesque aliquet tellus. > > > > > ### *