* using log directory ‘/data/gannet/ripley/R/packages/tests-Suggests/SeedMatchR.Rcheck’
* using R Under development (unstable) (2024-04-19 r86451)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
    gcc-13 (GCC) 13.2.0
    GNU Fortran (GCC) 13.2.0
* running under: Fedora Linux 36 (Workstation Edition)
* using session charset: UTF-8
* using option ‘--no-stop-on-test-error’
* checking for file ‘SeedMatchR/DESCRIPTION’ ... OK
* this is package ‘SeedMatchR’ version ‘1.1.1’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... NOTE
Package suggested but not available for checking: ‘org.Rn.eg.db’
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for executable files ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘SeedMatchR’ can be installed ... [8s/11s] OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking use of S3 registration ... OK
* checking dependencies in R code ... NOTE
Namespaces in Imports field not imported from:
  ‘cowplot’ ‘testit’
  All declared Imports should be used.
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... [10s/12s] OK
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd line widths ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking installed files from ‘inst/doc’ ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘SeedMatchR-Ex.R’ failed
The error most likely occurred in:

> ### Name: get_seed
> ### Title: Get the target seed sequence given a canonical seed name and
> ###   input sequence
> ### Aliases: get_seed
> 
> ### ** Examples
> 
> # Example Ttr from Schlegel et al. 2022
> guide.seq = "UUAUAGAGCAAGAACACUGUUUU"
> 
> # Get seed match
> seed.seq = get_seed(guide.seq, "mer7m8")
Error in loadNamespace(i, c(lib.loc, .libPaths()), versionCheck = vI[[i]]) : 
  there is no package called ‘GenomeInfoDbData’
Calls: get_seed ... loadNamespace -> withRestarts -> withOneRestart -> doWithOneRestart
Execution halted
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... [8s/13s] OK
* checking HTML version of manual ... OK
* checking for non-standard things in the check directory ... OK
* checking for detritus in the temp directory ... OK
* DONE

Status: 1 ERROR, 2 NOTEs
See
  ‘/data/gannet/ripley/R/packages/tests-Suggests/SeedMatchR.Rcheck/00check.log’
for details.

Command exited with non-zero status 1
Time 1:58.83, 78.39 + 11.69